fe9082 No.2249666
Welcome To Q Research General
We hold these truths to be self-evident: that all men are created equal; that they are endowed by their Creator with certain unalienable rights; that among these are life, liberty, and the pursuit of happiness.
Integrity–for in Truth lies Victory.
VINCIT OMNIA VERITAS
SEMPER FIDELIS
WWG1WGA
Welcome to Q Research (README FIRST, THEN PROCEED TO LURK) https://8ch.net/qresearch/welcome.html
Our Best of the Best Q Proof Bread >>1552095, >>>/qproofs/49 SEE FOR YOURSELF
Discussion and Refinement bread for our Best Q Proofs Sticky >>1739215, >>>/qproofs/130
100+ Q Proof Graphics download qproofs.com
Q Plan to Save the World - Video introduction to the Q plan - https://youtu.be/6cYZ8dUgPuU
HIGHLIGHTED Q POST
Q !UW.yye1fxo ID: 27d57d No.594016 ðŸ“
Mar 8 2018 19:55:52 (EST)
Anonymous ID: 576924 No.593959 ðŸ“
Mar 8 2018 19:53:28 (EST)
nov14.png ⬇
>>593825
>>593959
Thank you Kim.
Deal made.
Clowns out.
Strings cut.
We took control.
Iran next.
Q
Q's Recent Posts
We are aware of the issue with an accelerated pattern of some breads being 404'ed from /qresearch/.
Q's Private Board >>>/patriotsfight/ | Qs Tripcode: Q !CbboFOtcZs
FIND ALL Q POSTS AT: qanon.pub , qmap.pub/ , qanonmap.bitbucket.io/ , qanon.news/posts.html
Backup Q Posts (those still on the board) at https://8ch.net/qresearch/qposts.html or >>>/comms/226
Previous Q Posts
If qanonmap ever goes down, the mirrors are: qntmpkts.keybase.pub & qanonmap.bitbucket.io
* Spreadsheet: https://docs.google.com/spreadsheets/d/1Efm2AcuMJ7whuuB6T7ouOIwrE_9S-1vDJLAXIVPZU2g/edit?usp=sharing
* Q Raw Text Dump: pastebin.com/3YwyKxJE
Dealing with Clowns & Shills
>>2117975, How To Quickly Spot A Clown >>1838738, Freedom of Speech >>2064946 Useful Filters
fe9082 No.2249671
Notables
are not endorsements
GLOBAL
>>2174695 ; >>2174831 FULL VIDEO: President Trump and President Putin Helsinki Summit Press Conference
#2835
>>2248944 More legalized theft from the US government (that's us, people)
>>2248981 POTUS tweet again. Baker just can't see this enough
>>2249043 Pompeo's speech on Iran (at Reagan Library 7/22/18)
>>2249184 All Q Mentions of Iran (screen capture)
>>2248968, >>2249379 The Clintoons and Iranian & NK fuckery
>>2249434 Iran replies to POTUS tweet
>>2249441 Many Anons and Twatters are enjoying POTUS's recent Iran tweet
>>2249599 SpaceX Telstar Launch
>>2249637 Mueller past work history dig
>>2249661 #2835
#2834
>>2248144, >>2248177, >>2248307, >>2248791 Wolfe and Watkins and FISA Docs, oh my!
>>2248429 Added as notable again, just because I like it so much
>>2248525 Summary Graphic of "Iran is Next"
>>2248570, >>2248629, >>2248713, >>2248802 James Woods getting the most out of Twitter
>>2248839 #2834
#2833
>>2247620, >>2247641 Peter Strzok's Wife Blocked FBI Investigations on Clinton
>>2247610 Compilation of Secretary Pompeo Tweets to Iranian People
>>2247342 The NYT is the Iranian State Media (Graphic)
>>2247270 EPIC & BADASS Trump Twat to Rouhani of Iran /ourpresident/
>>2247966 #2833
#2832
>>2247102 The money plane. Planes full of cash, sound familiar? Browder...
>>2247096 Trump Talking About "Lights Out" in Video (Around 1:20 Mark)
>>2246903 Rainn Wilson Pedo Twats (ARCHIVE OFFLINE ANONS)
>>2246788 George Eliason Twat
>>2246782 Pimco Executive Bill DeLeon Resigns After Allegations of Inappropriate Behavior.
>>2246836 Remember the Cryptic Flynn Tweet "Dgfffcf"?
>>2246787 These Aspen Security Forum Transcripts Should be Interesting
>>2246727 Caleb Hull Twats Brennen Account only Has 45 Posts??? Where Did the Posts Go???
>>2246675 Bear Strikes Anagram
>>2246498, >>2246561, >>2246517, >>2247153 So…… Hitlery met with PUTIN ALONE - No way??
>>2246491 Oh My, This is Either A Sting -OR- The Most Corrupt U.S. Dept of Justice in History
>>2246480 Pompeo Tweet to the Iranian People (Also Translated toEnglish)
>>2247217 #2832
#2831
>>2246370 Disaster For Theresa May: Brits Overwhelmingly Reject New Brexit Plan; Turn To Boris, Farage
>>2246165 ClockFag Update for the Clockfags
>>2246157 Putus Schedule Tweet
>>2246146 Robert "Tosh" Plumlee Tweet (Who is this Guy?)
>>2246100 Carter Page & Jason Bourne Mentioned by 2 different People in Same Sentence on News Tonight
>>2246027 Planefag Updates
>>2245885, >>2245978, >>2246191 Tying the Clintons to Harvey Weinstein (Moar Sauce)
>>2245827 Rouhani Warns Trump About "Mother of all Wars"
>>2245760 House Intel (GOP) Wants POTUS To DECLASS FISA Application
>>2246451 #2831
#2830
>>2245420 why perp walking Weinstein is so critcal to this whole operation
>>2245146 Planefag update
>>2244874 Bill Browder is CIA agent, recruited Navalny.
>>2244962 Japan Inc. frets about a possible 'Bank of Amazon'
>>2244920 Dan Harmon pedo thread. (graphic)
>>2245048 Interesting theory on Trump Jr. and Stormy Daniels.
>>2245058 Corporations working to undermine Trump's tariffs.
>>2245420 , >>2245472 Tying the Clintons to Harvey Weinstein.
>>2246560 #2830
#2829
>>2244142 Mr. Roboto = RINO?
>>2244269 US launches campaign to erode support for Iran's leaders.
>>2244220 FBI hints at parallel construction.
>>2244745 How the FISA application papers support Nunes' February memo.
>>2246555 #2829
#2828
>>2243269 U.S. DoD Tweet - Shoot. Move. Communicate. 18th Security Forces Squadron in Japan
>>2243318 Italy and Libya Reject EU's Latest Migrant Crisis Plan
>>2243334 FISA Judges Dig
>>2243402 RT tweet regarding Furniture being removed from Equadorian Embassy
>>2243507 Small, low wing aircraft intercepted by a F16 near Trump's resort.
>>2243680 Pedophile psychiatrist busted by the DOJ for child porn possession.
>>2246545 #2828
Previously Collected Notables
>>2242308 #2827, >>2241485 #2826, >>2246530 #2825
>>2239163 #2822, >>2239965 #2823, >>2246391 #2824
>>2237286 #2819, >>2241994 #2820, >>2238353 #2821
>>2236331 #2816, >>2236344 #2817, >>2236370 #2818
>>2236323 #2815, >>2236272 #2814, >>2236254 #2813
Best Of Bread: https://8ch.net/qresearch/notables.html
Archives of Notables >>>/comms/225 ; >>>/comms/1536
fe9082 No.2249677
War Room
WHO IS #QAnon FIRE THE CANNONS
#WalkAway Redpill the patriots trapped under the dark delusion of neoliberalism see THE LIGHT of patriotism and conservatism
Tweet Storm: THE WAVE: hit them with everything you got! THINK MOAB BABY!
[1] #QAnon ON EVERY twat/reply/quote/post: This is how newbies & normies can find our twats'
[2] Throw in ANY EXTRA hashtags you want! Trending: #FakeNews, #MOAB #InternetBillOfRights #IBOR #MAGA, #Treason WHATEVER YOU WANT!
[3] Meme and Meme and Meme some MOAR! Your memes are what's waking up the normies.
Hit them hard, from all angles, with every meme you have, RT others tweets. KEEP GOING!
Be your own tweet storm army.
Useful twat hints on war room info graphs
CURRENT EXPOSURE #QAnon: 40 – 70 MILLION EXPOSURES/DAY!
Best Times to TWEET:
10-11 AM EASTERN /// AFTER 6 PM EASTERN
Wanna (re)tweet LASERFAST? Use TWEETDECK.com on laptop or PC
Anon Research Tools
>>974637 How to archive a website offline
Threads & Research Section
>>1552095 – Q Proofs Thread - Proofs of Q's Validity
>>1254488 – QBoard Questions (testing/ questions about how to post/italic/bold/etc)
>>1121104 – Q Questions Thread (post your Questions to Q here!)
>>1667382 — META
>>1215912 – Letters of Gratitude II
>>870846 — The Letter Q
>>1606439 – Notable Resignations Thread
>>32223 —– Qs Chess Game
>>256741 — Alien, UFO, Advanced/Hidden Technology, Antigravity, DUMBs, etc.
>>1420554 – Biblefags vs Unleavened Bread #2
>>618758 — Merkel research thread
>>1796608 – Human Sex Trafficking
>>911014 — Occult Music and Pop Culture
>>957083 — No Name Research Thread
>>1940204 – Nimrod World Order Research Thread
>>1844122 – A Place to Ponder Questions for the upcoming Q & A
>>2006252 – The 'BE HEARD' Project Thread: A huge choice of graphics and ideas for creating your own Q materials
>>2089271 – New chat bread to try to take burden off QResearch off-topic discussion >>2089312
>>2178691 – NEW Executive Summaries on Each Q Subject Thread - Project
Q Graphics all in GMT
Q Graphics all in GMT #01-#05 >>>/comms/486 , >>>/comms/487 , >>>/comms/488
Q Graphics all in GMT #06-#10 >>>/comms/488 , >>>/comms/489 , >>>/comms/490
Q Graphics all in GMT #11-#15 >>>/comms/491 , >>>/comms/545 , >>>/comms/950
Q Graphics all in GMT #16-#20 >>>/comms/951 , >>>/comms/952 , >>>/comms/953 , >>>/comms/987 , >>>/comms/1103
Q Graphics all in GMT #21-#25 >>>/comms/1119 , >>>/comms/1156 , >>>/comms/1286 , >>>/comms/1288 , >>>/comms/1303
Q Graphics all in GMT #26-#30 >>>/comms/1307 , >>>/comms/1462 , >>>/comms/1466, >>>/comms/1489, >>2033995
Q Graphics all in EST
Most recent compilation ————————————————————————— >>>/comms/1269
Qmap_graphic_2018-05-14_patriotsfight/80-81-82 ————————-—————– >>>/comms/1189
Qmap_graphic_2018-05-04_patriotsfight/TRIPUPDATE/58 + full thread captures >>>/comms/1194
Qmap_graphic_2018-04-21_2018-04-22)_Earth Day_.jpg ——————————– >>>/comms/968
Qmap_graphic_2018-04-17_2018-04-21_They think they are clever).jpg ———— >>>/comms/967
Qmap_graphic_2018-04-10_2018-04-16_TheWHERE-TheWHY).jpg ———-——– >>>/comms/966
fe9082 No.2249680
QPosts Archives in All Formats
* Q Clearance Archive: irc.qclearancearchive.net > browsable versions of /thegreatawakening/ from before the purge, image archives, resignations, sex trafficing arrests,
* Spreadsheet Q&A and all images backup: docs.google.com/spreadsheets/d/1Efm2AcuMJ7whuuB6T7ouOIwrE_9S-1vDJLAXIVPZU2g/
* Spreadsheet Timestamps/Deltas: docs.google.com/spreadsheets/d/1OqTR0hPipmL9NE4u_JAzBiWXov3YYOIZIw6nPe3t4wo/
* QPosts Archive and More at qmap.pub features All Q Posts/ Players in the Game/ Analytics on Q posts (top tags, players, posts per month)/ All Resignations: https://www.resignation.info >>1606439
* Searchable, interactive archive with user-explanations: qanon.pub (Backup: qntmpkts.keybase.pub & qanonmap.bitbucket.io)
* QMap PDF (Version > 9.5.0 [updated 6/25]) >>122807
* QAnonProofs.com
* Q Proofs https://www.qproofs.com/home.html
* Q Raw Text Dump: pastebin.com/3YwyKxJE
* Expanded Q Text Drops: pastebin.com/dfWVpBbY
* QMap zip: enigma-q.com/qmap.zip
* Full JSON Q archive: qanon.news/Archives (~135MB/~817MB Unzipped) [Updated: 4/20/2018]
* Search by post number: http://qanon.news/posts.html for printing crumbs, sorted by timestamp
* https://commandandcontrol.center/ aggregation of twitter feeds, Qanon.pub, meme making/archiving/research tools
* Original, full-size images Q has posted: https://postimg.cc/gallery/29wdmgyze/
* API Q posts: https://qanon.news/help
*Book of Q Proofs https://mega.nz/#F!afISyCoY!6N1lY_fcYFOz4OQpT82p2w
Tweet Tools
* Deleted Trump Tweets: https://factba.se/topic/deleted-tweets
* POTUS' Tweet Archive: trumptwitterarchive.com
* Merge QT - Awesome archive of Q Posts and POTUS Tweets in Chronological order: https://anonsw.github.io/qtmerge/
* All My Tweets: Archive/Scan any Twatter account in text form: https://www.allmytweets.net/
Other Tools
* Q Happenings Calendar of 2018: https://mega.nz/#F!KPQiBJiY!dK3XRe4RYoXgWq_85u4-yg
* Qcode Guide to Abbreviations: pastebin.com/UhK5tkgb
* Redpill Flag / Printable Q Cards with QR Link: >>1556905
* Stock Movement Scraper: http://qest.us (for seeing LARGE movements of $)
* Memo & OIG Report Links: 8ch.net/qresearch/res/426641.html#427188
* Legal News: www.justice.gov/usao/pressreleases
* WebAlert App: can be used to create alerts for Qanon.pub
* Federal Procurement Data System: https://www.fpds.gov/fpdsng_cms/index.php/en/
* Sealed Indictment Master: https://docs.google.com/spreadsheets/d/1kVQwX9l9HJ5F76x05ic_YnU_Z5yiVS96LbzAOP66EzA/edit#gid=1525422677
Research Section Backup >>>/comms/220 (updated 5.5.18)
* Behold A Pale Horse: >>>/pdfs/6157
* Resignation Posts Search Tool: https://www.resignation.info/scripts/8chan/search.php
* Advanced Google Search Operators: https://ahrefs.com/blog/google-advanced-search-operators/
Q Research Graphics Library
https://mega.nz/#F!XtNhURSb!1Mdrvt-Y_onBw5VlFDRdCQ
22,500+ memes and infographs, keyword searchable, partially organized by topic
Advanced Graphics
>>1842783 Advanced Graphics, Proofs, Maps, Side-by-Sides, Good Memes
Meme Ammo Stockpiles
26, >>2163922, Templates >>113884
Meme Generator kek.gg/draw/
Archives
MasterArchivist ------------------------ qarchives.ml | masterarchivist.github.io/qarchives/
Supplement to MasterArchivist ---- main spreadsheet, 2nd tab (labeled) --- https://docs.google.com/spreadsheets/d/1M2AzhZKh2PjL7L7GVPN42Em0hZXKWMdhGnj59ZQ3YcQ/
Germanarchiveanon ------------------ https://mega.nz/#F!LPZxEIYJ!N5JwCNoxOxOtAoErKdUgvwa
QAnon.news anon --------------------- https://qanon.news/Archive (~260MB/~1.5GB Unzipped) [Updated: 6/08/2018]
Learn To Bake!
Aspiring Bakers Report To Class and/or >>>/comms/154
Read the Simple Instructions https://pastebin.com/aY5LyDPY
==New Bakers Required == Read this ---> >>2172540
fe9082 No.2249684
Dough
https://pastebin.com/9FJvydBm
fe9082 No.2249725
ad01da No.2249727
Malapropism: incorrect usage of a word by substituting a similar-sounding word with different meaning
"Trust"
"Plan"
408ac7 No.2249729
when SHIA LABEOUF comes out and admits he was rapped as a youngster and is coming back to take down pedowood…
They never thought Even Stevens had it in him.
LABEOUF OR BUST.
or last hope..
ever wonder why he's been distancing himself from hollywood so much whilst self crucifying himself?
He's about to drop the hammer.
fa085a No.2249730
>>2249663
You post too much…your a jew mossad JIDF type. Fück off. Your Jew tricks do not work here. Dan will be innocent or guilty on facts. Facts that we will know soon enough.
This is likely an attempt to stop season 4 of Rick and Morty. This is a limited hangout attempt. JUST LIKE WITH DONALD TRUMP. The Jews created the MeTOO movement to create a ground swell of women crying out for justice. They assumed with their Jew media they could make it into a hurricane of sorts. They began to knee jerk fire people in Hollywood to build the momentum…..all to build for the press conference with the women saying Trump was a molester. METOO was not started by brave women…the women are still acting. This is hollywood. They were a weapon aimed at TRump.
Attacking Dan Harmon is another fucking Mossad trick to break a TV show that is amazingly popular and has shown they will mock anything and redpill like crazy.
Fucking think moron.
567af9 No.2249733
>>2249707 (lb)
Does that save the thumbnails also?
d6154b No.2249737
>>2249730
Does Rick and Morty get your dick hard
Used to be good it's just garbage now
408ac7 No.2249738
>>2249734
anyone else ever had that russian doll metaphysical experience shown to them when deep on the chans ?
b33ac9 No.2249739
>>2249669 (lb)
I like the ideas you say he's working towards, and admit mostly ignorant about this guy.
Will dig.
Michael C. Ruppert said something to the effect of, "Until you change the way money works, nothing changes."
fe3ba6 No.2249740
>>2249734
Nbody figured that out, correct? It wasnt that failed bill. My mind keeps going to Children of Virgin…something something something..
d8a7ae No.2249741
I'm still skeptical about Friday. I'm waiting for the October surprise…
Fixing everything happens first and it's just all threats that don't happen until things are fixed. Then the indictments drop.
9071f4 No.2249742
lb
>>2249696
Eddie Murphy is not the guy, not even close. Eddie Murphy has had his ass popped. Once they have dressed a black actor up as a girl they have been ass popped.
b2848d No.2249743
How is the Qanon hashtag going with Iranians this morning?
09138b No.2249745
>>2249554 lb
If this is important to you, I would get in touch with GermanAnon. If any of those recent breads still exist, he could probably get them archived. Could the early breads be on one of the other archive sites? I guess they have not been maintained for some time. If not, maybe other anons might have them in a personal archive.
>>2249563
Link is 404.
59fe22 No.2249747
>>2249685 LB
>Someone said Stealth Jeff was part of the Reagan Battalion and a Never Trumper
>True?
could be true, but he has doxed himself and is writing a book how he left the darkside after seeing what GEOTUS was accomplishing.
ad01da No.2249748
Anaphora: A scheme in which the same word or phrase is repeated at the beginning of successive phrases, clauses, or sentences. Example: "I will fight for you. I will fight to save Social Security. I will fight to raise the minimum wage."
275d61 No.2249750
>>2249722
Yep. That's him. You are right.
>>2249742
I know.
d6154b No.2249752
>>2249745
There's no reason why the July breads aren't on Qresearch, fuck paying money to mega.nz to look at breads
7d0147 No.2249753
>>2249712
And I'm aware that normies aren't supposed to be here. I don't give them direct links. Rather, I give them something to edit if they know the site and board. One of the things I've been doing on my site is providing better context for posts. If they go to a Q post, for instance, they can see the context chain going back 3 or 4 posts or more–as many as there are in that context. It's amazing how much the meaning can clear up just doing that. My site was originally built as a tool to build posts for the blog that's at the front end of the site. It's been a while since I've updated that, but I'll probably do it eventually. I'll create posts by auto-generating them. A Q post or a notable is the heart of the blog post. Context is shown with it. It's more for the normies, perhaps.
9cd91d No.2249754
>>2249386 lb
Above comment contained the AP version of the Trump Tweet story about Iran. Attached pics show the Bloomberg and the UPI coverage of the President's tweet plus the prior speech of Secretary of State Pompeo in California and Iranian President Rouhani in Tehran. This background info helps put matters into perspective as to what led up to the tweet as well as capturing the articles before they get changed.
9564c5 No.2249755
fe9082 No.2249756
BV, can you add my present hash to the bakers' list? As you can see from my last two bakes,I'm the real TZB.
2e9175 No.2249757
>>2249725
baker here
TY for the perfectly baked bread, baker!
Confirming Handoff?
ae7b0b No.2249760
I don't know if this has been covered, but there is a doctoral candidate compiling stats for missing Native American and Indiginous Canadian women.
The interesting thing is that there was a bill called Savannah's Act introduced by Senator Heidi Heitkamp (and also Tester, Franken, Warren, Heinrich, and Merkley) on 5 October 2017, and last action on it was taken on 25 October 2017 (three days before Q's first post).
The purpose of the bill was:
>To direct the Attorney General to review, revise, and develop law enforcement and justice protocols appropriate to address missing and murdered Indians, and for other purposes.
>This bill requires the Department of Justice (DOJ) to update the online data entry format for federal databases relevant to cases of missing and murdered Indians to include a new data field for users to input the victim's tribal enrollment information or affiliation.
I'm guessing there hasn't been any "action" on this bill in the because it is being handled re: the human trafficking crackdown.
https:// www.npr.org/2018/07/21/627567789/doctoral-student-compiles-database-of-indigenous-women-who-ve-gone-missing?utm_source=twitter.com&utm_medium=social&utm_campaign=npr&utm_term=nprnews&utm_content=20180722
https:// www.congress.gov/bill/115th-congress/senate-bill/1942/text
b2848d No.2249761
>>2249751
With his soon to be supervisor, ClockBoy
9cd91d No.2249762
>>2249754
Sauce for screencaps:
https://www.upi.com/Top_News/World-News/2018/07/22/Irans-president-warns-Trump-of-mother-of-all-wars-if-provoked/9991532267432/?utm_source=sec&utm_campaign=sl&utm_medium=12
https://www.bloomberg.com/news/articles/2018-07-23/trump-warns-iran-s-rouhani-to-never-ever-threaten-the-u-s
https://www.bloomberg.com/news/articles/2018-07-22/iran-president-warns-trump-not-to-threaten-country-s-oil-exports
d7fb5c No.2249763
>>2249752
no need to pay
i've d/l countless breads from mega
no money changed hands
fe9082 No.2249765
>>2249757
Handoff Confirmed
Thanks, Clam. BV, can you confirm Clam's hash? I must leave my keyboard now.
2b6fce No.2249766
>>2249753
We are lucky to have you.
021485 No.2249767
>>2249745
nothing is deleted. here is the entire bread number 2560 in PDF form from the archive.
Yes there is something going on, but NOTHING is being deleted.
5da43b No.2249768
THIS IS SUPER SECRET STUFF
SO WE HAVE TO USE SUPER SECRET CODES
[GOOG]
77e319 No.2249769
>>2249729
And then we will take his flag. Again.
35d493 No.2249770
>>2249684
>>2249765
God bless and thank you guys.. It's been a rough ride since the end of June..
408ac7 No.2249771
>>2249769
testing the waters to see how reliable and competent autists were…
fa085a No.2249772
>>2249715
Dan is a drunk. He does not know how to keep a woman. But this is old news.
This Megan Ganz is a woman who is being manipulated into attacking Dan now. To destroy a Red Pill show that appeals to younger people.
METOO was not started organically. It was an attempt by Jews to create a ground swell against sexual predatory men not to help the women but to create momentum to take Donald Trump out of office.
You remember all that? You remember Weinstein saying "he was picked to start a new era in sexual rights" or some shit like that. The Jew sacrificed Weinstein to help take out Trump. You remember when Trumps own UN Indian Bitch said basically Trump should step down?
This is planned.
ad01da No.2249773
Antanaclasis – is the stylistic trope of repeating a single word, but with a different meaning each time. Antanaclasis is a common type of pun, and like other kinds of pun, it is often found in slogans
"Trust plan" "trust plan" "trust plan"
59fe22 No.2249774
>>2249747
https://twitter.com/drawandstrike/status/1021195539638046721
fe3ba6 No.2249775
>>2249734
>>2249734
Just was randomly looking into fefe….
assuming "cov" was solved, even if I was wrong….
found this….
https://www.parents.com/baby-names/fefe/
Consumer of Virgin Fefe
77e319 No.2249777
>>2249771
We are wide awake. Just a little distracted with pedogate.
408ac7 No.2249779
meme magick…
SHIA IS OUR SAVIOR
09138b No.2249780
>>2249718 lb
Apologies anon. I tagged wrong post.
I disagree with your assessment that bakers do whatever willy nilly feels good. In fact, I don't see what your issue is. The Qlinks are broken because they can't link to an active bread. That is something everyone seems to understand, but you. If you want regular q links, then you need to talk to Q about that since he hasn't posted in 19 days and probably 200 breads ago.
Demanding things are the way you want them isn't going to be very effective around here, but feel free to try, if you like.
e9b66c No.2249781
>>2249725
>>2249757
>>2249765
Handoff monitored. Hi Clam!
9cd91d No.2249782
The suicides …
https://apnews.com/cee3a7acb0544bd4b81fe1cf336fc182/Prominent-S-Korea-politician-found-dead-in-possible-suicide
Prominent S Korea politician found dead in possible suicide
By HYUNG-JIN KIM
Today
SEOUL, South Korea (AP) — A prominent liberal South Korean lawmaker embroiled in a corruption scandal was found dead on Monday, police said, in what appeared to be one of the country’s highest-profile suicides in recent years.
Three-term lawmaker Roh Hoe-chan of the small opposition Justice Party was found dead near a Seoul apartment building on Monday morning. Paramedics tried to resuscitate him before he was pronounced dead, police said.
South Korean media including Yonhap news agency reported Roh leapt to his death from the building after leaving a suicide note saying he feels sorry to his family.
Police said they couldn’t immediately confirm the report.
Roh faced an investigation over an allegation that he received money from an associate of an influential blogger jailed over an online opinion-rigging scandal. The allegation tarnished Roh’s clean and reform-minded image.
The independent counsel investigating the rigging scandal, Huh Ik-bum, told a televised briefing that he feels distressed with the “tragic news” of Roh’s death. Huh said he personally “respects” Roh and will pray for his soul.
South Korea has one of the highest suicide rates among developed countries. A string of business executives, K-pop stars and other celebrities have killed themselves.
If Roh’s death is determined as a suicide, he would be the highest-profile politician who killed himself or herself since former President Roh Moo-hyun jumped to his death in 2009 amid a corruption scandal involving his family.
5da43b No.2249783
When the Christ has returned, he'll just tell you, he'll just say, here I Am
af56b5 No.2249786
'Get the F*** Out of This City': Teen Harassed in Seattle for Wearing 'MAGA' Hat
insider.foxnews.com/2018/07/21/maga-hat-wearing-teen-harassed-seattle
bdfcab No.2249787
>>2249751
Hogg rides a bike without a seat.
bf7538 No.2249788
>>2249769
Normies get off my stream!
Just watched some recaps of that the other day
So many good moments
fa085a No.2249789
>>2249737
Rick and Morty is a tool for US. It uses genius humor and clever jokes to show the insanity of the world.
It is a weapon in OUR arsenal.
If the Jew liked Dan Harmon they would not have fought so hard to not sign them for season 4.
Now they want to kill it. LIke the Jew killed Roseanne.
567af9 No.2249791
>>2249760
Wasn't there a Q post having to do with the BIA or the native Americans? I just checked qmap.pub but could find nothing. I did notice the site has changed the post numbering system to match qanon.pub though.
d6154b No.2249792
>>2249781
BV can you comment on July's breads being removed from /qresearch/ while breads from May/June are still active?
2e9175 No.2249793
>>2249765
Acknowledged
Thanks for personally carrying the MAGA across the pond for us, TZ. Oi!
>>2249781
Hi BV! Ty for da czechs
>>2249770
YW anon.
We sail thru the rough waters
to get to that sweet, sweet shore
Thanks for helping, it's a team thing
WWG1WGA
16bb98 No.2249794
>>2249640 (pb)
It's not a joke.
If you think it's a joke there's something wrong with you . It's social conditioning to think "fucking children" jokes are funny.
No one is stopping him from whatever he wants to do or say. But we are also allowed to call it out, if he is full of shit; unfunny, And deserves to have a smaller audience.
I don't give a fuck if he is mentally ill, so are a lot of people who don't have broadcast contracts. (Paranoids, for one, tend to be funny as hell when they are on a roll? since they often tell the truth for the surprise factor [OMG factor], for example.) Maybe he was trying to tell the truth with his sick jokes - and this was the only way he knew how? But it seemed more he was glorifying it. He wasn't mocking pedos. He was mocking people who who thought it wasn't alright to say what he was saying. It was defiant, not revelatory. I'm not his boss. I don't pay him. I have no idea who he is, either, other than seeing his sick jokes. And truly I don't want to know more. And I hope he loses his job.
(I don't like Cernovich either. They [media personalities] "famefags" one way or another, are all a bad lot.)
>"One episode had the Characters begging a Trump stand-in to KILL anyone who refused to give up power. "
Have no idea why writer would claim this to be a Red Pill? Really
>"So the over the top doll rape scene shows his lack of understanding of the nature of the Jewish fetish of raping kids."
What? Did I really spend so much time responded to this ridiculous post? I'm a sucker.
Let's all defend pedo "jokes".. Wow.
(Image I picked for this post matches the number of this thread)
ad01da No.2249795
Syllogistic fallacies are formal fallacies that occur in syllogisms. They include:
Any syllogism type (other than polysyllogism and disjunctive):
fallacy of four terms
Occurring in categorical syllogisms:
related to affirmative or negative premises:
affirmative conclusion from a negative premise
fallacy of exclusive premises
negative conclusion from affirmative premises
existential fallacy
fallacy of the undistributed middle
illicit major
illicit minor
fallacy of necessity
Occurring in disjunctive syllogisms:
affirming a disjunct
Occurring in statistical syllogisms (dicto simpliciter fallacies):
accident
converse accident
d8a2fb No.2249797
Guess now it's time to start digging on Nadler
6cf3dc No.2249798
>>2249673
Not necessarily - look what happened to Leader Technologies. Also the "patent review process" subsequent to Dept. of Commerce and USPTO infiltration. Pritzker's in bed with (((them.)))
UN's also taking increasing role.
77e319 No.2249801
>>2249788
It is something that I will always remember and cherish.
4fd2d2 No.2249802
Baker & All Anons
the note at the top is nice but not sufficient, especially not for the New Arrivals which Q mentioned.
please use the regular formatting for the next bread, to fully address the problem:
(i have provided you the links here, which are all working, altho i'm sure you can copy paste from the previous correctly formatted bread header)
Q's Latest Posts
Q's Private Board >>>/patriotsfight/ | Qs Tripcode: Q !CbboFOtcZs
Wednesday 07.04.18
>>2029255 ————————————————— Independence Celebration ←———–put the notice HERE.
Tuesday 07.03.18
>>2022737 https://8ch.net/qresearch/res/2022006.html#2022737 rt >>2022584 https://8ch.net/qresearch/res/2022006.html#2022584 ——————————— Who do you see?
>>202258 4https://8ch.net/qresearch/res/2022006.html#2022584 —————————————————- United 747 (Retired) Through Blinds at SFO Global First Lounge
>>2022398 https://8ch.net/qresearch/res/2022006.html#2022398 rt >>2022233 https://8ch.net/qresearch/res/2022006.html#2022233 ——————————— Trolling is Fun. Hussein/Trump interior = identical minus small changes.
>>2021248 https://8ch.net/qresearch/res/2020479.html#2021248 rt >>2019981 https://8ch.net/qresearch/res/2019727.html#2019981, >>2021248 https://8ch.net/qresearch/res/2020479.html#2021248, >>2020544 https://8ch.net/qresearch/res/2020479.html#2020544 Do 'reflections' violate NAT SEC rules?
>>2018075 https://8ch.net/qresearch/res/2017360.html#2018075 —————————————————- Divide they try. Fail they will.
>>2017327 https://8ch.net/qresearch/res/2016598.html#2017327 rt >>2016766 https://8ch.net/qresearch/res/2016598.html#2016766 ———————————- WelcomeAboard.png (Picture from inside AF1)
>>2014318 https://8ch.net/qresearch/res/2014292.html#2014318 —————————————————- Add another to the list
>>2014158 https://8ch.net/qresearch/res/2013512.html#2014158 rt >>2013625 https://8ch.net/qresearch/res/2013512.html#2013625 ——————————— Matters of National Security
Previous Q Posts
Backup Q Posts (those still on the board) at https://8ch.net/qresearch/qposts.html or >>>/comms/226
Find All Q Posts At: qmap.pub/ qanonmap.bitbucket.io/ qanon.pub
If qanonmap ever goes down, the mirrors are: qntmpkts.keybase.pub & qanonmap.bitbucket.io
* Spreadsheet: https://docs.google.com/spreadsheets/d/1Efm2AcuMJ7whuuB6T7ouOIwrE_9S-1vDJLAXIVPZU2g/edit?usp=sharing
* Q Raw Text Dump: pastebin.com/3YwyKxJE
c90222 No.2249803
What if the man in Q's picture is Prince William?
Hear me out before you all laugh. Many of us believe that Julian Assange is no longer at the Ecuador embassy. It would take very high level individuals within the UK to make it possible for Assange to escape. What if William helped him get out? Q has let us know that JFK jr was in fact murdered. A few years prior to that, princess Diana was also murdered. We always assumed that the Queen had Diana killed, at least that's what all of the conspiracy theories lead to. But what if it's deeper than that. Q told us that North Korea had been taken over by cabal. What if the Royal Family has been blackmailed strong armed too. It doesn't matter how terrible someone might be, if you harm their mother, there will be hell to pay! William lost his mother and would probably love to bring those responsible to justice. If William wanted to bring down some of these people, the first and only move he would have to pull would be to free Julian Assange. If Assange ever gets the opportunity to testify in a US court, it will start a chain reaction that won't be able to stop.
e9b66c No.2249805
>>2249792
Not sure what's up with that. Sorry, Anon! I'll look into it.
09138b No.2249806
>>2249752
you shouldn't have to pay for any archive.
see
>>2249767
Thanks anon for the archive link. Hopefully that helps anons who didn't have it. Hats off to you.
408ac7 No.2249807
>>2249794
anyone notice after SHIA's "meltdown"
he went from always throwing up the OK or 666 hand sign to a THUMBS UP or DOUBLE THUMBS UP?!
55c4f1 No.2249808
>>2249780
I don't Q is gonna fix that problem for you.
Since there are negligible rules here there is negligible responsibility
Welcome to Anarchy - you have learned a great political/social/economic lesson about that type of Utopian government
Don't hold your breath for a solution - anarchies don't end well
d6154b No.2249809
>>2249802
baker, BV, BO
2nded
ad01da No.2249810
An enthymeme (Greek: ἐνθύμημα, enthumēma) is a rhetorical syllogism (a three-part deductive argument) used in oratorical practice. Originally theorized by Aristotle, there are four types of enthymeme, at least two of which are described in Aristotle's work.[1]
Aristotle referred to the enthymeme as "the body of proof", "the strongest of rhetorical proofs…a kind of syllogism" (Rhetoric I.I.3,11). He considered it to be one of two kinds of proof, the other of which was the paradeigma. Maxims, Aristotle thought to be a derivative of enthymemes. (Rhetoric II.XX.1)
6285b8 No.2249811
>Mr. Trumps unprecedented decision, which he made over the objection of law enforcement and intelligence officials, had a consequence that revealed his gambit's shaky foundation. The government released the court documents in which the FBI made its case for conducting the surveillance - records that plainly demonstrated that the key elements of the Republicans' claims about the bureau's actions were misleading or false.
Holy kek, the fake news just doesn't stop.
Image from Stealth Jeff.
408ac7 No.2249812
3a55f7 No.2249813
Demond Wilson - Wounded Viet Nam war vet. Renegade?
https://military.wikia.com/wiki/Demond_Wilson
7d0147 No.2249814
>>2249767
It's good we have these somewhere. Is anyone archiving the full-size images? Quite a lot of the generated intel here is in image form. I've got some, but not all. The ctrl-s thing doesn't work well with those. If they're not all buffered in, I just get the thumbnails again.
2a2b03 No.2249816
>>2248981
Seen this before, haven't we…
Iran is already settled.
Zionist doomsday morons would make you believe otherwise. Their mind is set on one thing. Armageddon. Won't happen!
35d493 No.2249817
https://8ch.net/qresearch/res/2246931.html#2249790
Someone was thankful in the catalog overnight. Just thought I'd point it out in case something something stuff…
d8a7ae No.2249818
>>2249741
Well, actually kind of interesting here…
https://en.wikipedia.org/wiki/Mission:_Impossible_%E2%80%93_Fallout
more spoopiness
ad01da No.2249819
YouTube embed. Click thumbnail to play.
A Chewbacca defense is a legal strategy in which the aim of the argument is to deliberately confuse the jury rather than to factually refute the case of the other side. This term was used in an episode of the animated series South Park, "Chef Aid", which premiered on October 7, 1998. This episode satirized attorney Johnnie Cochran's closing argument defending O. J. Simpson in his murder trial. The concept of disguising a flaw in one's argument by presenting large amounts of irrelevant information has previously been described as the modern-day equivalent of a red herring or the fallacy ignoratio elenchi (irrelevant conclusion).[1][2]
408ac7 No.2249821
thoughts on this breadcrumb?
ae7b0b No.2249822
>>2249791
I don't remember one off the top of my head. I'll keep looking for any Q posts that connect.
fa085a No.2249825
>>2249794
You are being Jew tricked. Someone who makes his living making rude jokes can go over the line. Which in todays world where we know how much kid fucking is really going on the joke is not funny. It was not really a joke before but designed to make you cringe. It was designed to show you how insane fucking a kid is.
Watch very carefully who the Jew screams needs to be taken down. You should use a short hand. I will make it easy for you. STOP BELIEVING JEWS.
You will be better off just not paying a Jew any attention till this whole NWO shit is done and ove r with.
Be very careful who Jews say is a bad guy. The Jew/Luciferians reverse and mirror EVERYTHING>
9564c5 No.2249828
>>2249804
oh shit maybe Q team deleted certain bread links
7c17f2 No.2249829
Off topic but another weird coincidence
77e319 No.2249830
>>2249821
My thoughts are that you are (((AFLB's))) little bitch.
c93bf5 No.2249831
https://theconservativetreehouse.com/2018/06/08/the-bigger-story-behind-the-james-wolfe-indictment/
https://twitter.com/rohnson_john/status/1005496788600672257
^Graphic draws a connection between Ben Rhodes and a lawyer, but James Wolfe's wife is Jane Rhodes-Wolfe. The GQ 50 Most Powerful People article cites Ben and David Rhodes mother as Jane Rhodes. One and the same?
https://www.gq.com/gallery/50-most-powerful-people-in-washington-dc#slide=49
Couple other interesting screen pulls of the 50 list, too.
35d493 No.2249832
>>2249802
>anon finds "deleted" posts
I knew it. Shadilay!
There's still catalog issues imo. Yeah it's "working".. but not on all cylinders.
I'm still blaming Fungus. The timing of their implosion is just too fucking coincidental.
16bb98 No.2249833
>>2249825
Go to hell, jew hater.
77e319 No.2249834
f814b7 No.2249835
>>2249775
COVFEFE =
Communications Over Various Feeds Electronically for Engagement Act
ad01da No.2249836
Post-truth politics (also called post-factual politics[1] and post-reality politics[2]) is a political culture in which debate is framed largely by appeals to emotion disconnected from the details of policy, and by the repeated assertion of talking points to which factual rebuttals are ignored. Post-truth differs from traditional contesting and falsifying of facts by relegating facts and expert opinions to be of secondary importance relative to appeal to emotion. While this has been described as a contemporary problem, some observers have described it as a long-standing part of political life that was less notable before the advent of the Internet and related social changes
021485 No.2249837
>>2249806
>>2249752
You do not have to pay for archives. Qanon.pub has a folder icon next the the link, that will take you to the archive of that bread.
fe3ba6 No.2249838
>>2249797
>>2249797
Its getting funnier and funnier watching them project exactly what they were doing and exactly what is coming for them… onto this Admin. I truly hope they are playing a role and are just really bad at it… because THESE PEOPLE ARE STUPID
77e319 No.2249839
>>2249833
Jew haters go to heaven.
There are no jews in heaven.
That is why it is heaven.
fa085a No.2249840
>>2249833
No. That is not going to happen.
Trump is here to bring down ZOG. Trump will save the normal Jews. But God is done with the kid fucking cannibals. And no amount of tricks will save them now.
d6154b No.2249841
>>2249832
Most of those links 404
55c4f1 No.2249842
>>2249821
As it relates to Q research?
Pointless and needlessly offensive to some
ad01da No.2249843
>>2249836
See also
https://en.m.wikipedia.org/wiki/Dead_cat_strategy
2b6fce No.2249844
>>2249828
it's possible.
i don't see why he would.
i meant wouldn't, wouldn't.
5da43b No.2249845
I won't judge you
I love you!
9564c5 No.2249846
these are the top tweets under the rouhani trend on twitter smfh
7d0147 No.2249849
>>2249828
Not likely the Q team. Unfortunately, this project has attracted some hackers.
af56b5 No.2249850
>>2249754
I posted the AP stories (lb)
Thanks for adding even more info
The post from anon pointing out that POTUS did not threaten Iran but rather tweeted specifically at the President prompted me to want to keep the story documented as MSM likely changes it
d6154b No.2249851
>>2249837
Thanks a million, anon.
4fd2d2 No.2249853
>>2249841
every single one was working until that was posted. let that sink in.
408ac7 No.2249855
>>2249826
>>2249826
do you think his installation was intimate and he actually cared?
or did you ever think he knew he would be trolled and made it as an excuse to show how inhumane and fucked up you guys can be?
see photo of man punching woman…
also a man causing a riot…
men punching women and being arrested and proven Neo Nazis is cool.
Fuck you guys are bored, just glowing for any kind of sense of meaning.
1a7199 No.2249856
>>2249725
Backup Baker riding early morning shift as well. Shadilay Anons
fe3ba6 No.2249857
>>2249835
>>2249835
I know … I saw that a while back. Its something deeper. POTUS shook killary on stage with that one word. It wasnt about that. I feel they named it that just to cover what may come in the future. Its gotta be something else.
09138b No.2249858
>>2249837
All this time and I never knew that. ThanQ!!!!!
408ac7 No.2249859
>>2249848
>>2249848
is that the DEMIURGE?
4fd2d2 No.2249860
Good Anons:
Get your baker license NOW.
Start baking ASAP.
b2848d No.2249861
>>2249846
A little ditty
about @Jack and Iran
021485 No.2249862
>>2249835
FFS how many times do we have to go over this.
H.R.2884 - 115th Congress (2017-2018): COVFEFE Act of 2017 was a "GOTCHA" bill passed AFTER POTUS's odd tweet.
Fucking do at least the slightest bit of research before you post your idiotic opinions as fact.
7d0147 No.2249863
>>2249858
I don't charge anything for my site, either. And there are no ads on it.
9564c5 No.2249864
anons i need to get off this board i'm gaining weight and my life is in shambles
i had personal goals
i had a good routine and habits
i had a life
and now i have pepe memes and nameless faceless internet "friends" who call me faggot every day
and am probably on some clown hit list
ad01da No.2249866
>>2249859
Paradeigma (Greek: παραδειγμα) is a Greek term that refers to a pattern, example or sample. In rhetoric, a paradeigma is used to compare the situation of the audience to a similar past event, like a parable. It offers counsel on how the audience should act.[1] In the Greek tradition many paradeigmas are mythological examples, often in reference to a popular legend or well-known character in a similar position to the audience.[2]
The term "paradigm", a distinct concept or pattern, is derived from the Greek term paradeigma.
4fd2d2 No.2249868
>>2249864
you just need better time management anon.
list priorities in order of importance.
follow thru list in that order.
9564c5 No.2249869
>>2249853
seriously?? how are they taking them down so fast..
d7ff5f No.2249870
>>2249840
THIS! They must really believe we are as murderous as they are. Just goes to show.
2b6fce No.2249871
>>2249864
Go have a life, we got it. Come back restored
or never come back but PRAY for us.
1a7199 No.2249872
>>2249864
Why even post this? You think you are alone in losing your life being here? I STAY AND FIGHT !. YOU RUN FAGGOT, WE GOT THIS.
d7fb5c No.2249873
>>2249860
i'm sure there is always a few 'oldfag' bakers lurking at most times
i'll step up if needed , but there is always others that seem keen to bake
858d11 No.2249874
>>2249864
screw you faggot! don't you read the bread? learn to use the index! we already discussed that last bread. Q never said that. I've been here since the beginning. TYB. and, of course, kys
kek
408ac7 No.2249875
Renegade is Stevie Wonder?
1a7199 No.2249876
>>2249866
I like how you put yourself in the kill box. Future proves past.
7d0147 No.2249877
>>2249869
Hmmmm…. Site is infected?
ad01da No.2249878
Contra principia negantem non est disputandum (Latin, alternatively Contra principia negantem disputari non potest and Contra principia negantem disputari nequit; literally, "Against one who denies the principles, there can be no debate") is a principle of logic and law: in order to debate reasonably about a disagreement, there must be agreement about the principles or facts by which to judge the arguments.
408ac7 No.2249879
>>2249864
>>2249864
MKULTRA'D by this board.
edd710 No.2249881
CDAN sounds like EU Jean Claude Juncker
59fe22 No.2249882
>>2249862
also Cobalt Vanadium Iron Alloy, also CoVFeFe
https://www.americanelements.com/iron-cobalt-vanadium-alloy
b2848d No.2249884
Expect new Q codes and shit on /patriotsfight/ tomorrow. It's go time
ad01da No.2249886
Arthur Schopenhauer refers to it in his "The Art of Controversy,"[5] and Lenin objected to Peter Berngardovich Struve's assertion of the principle, retorting, "That depends on how these principia are formulated—as general propositions and notes, or as a different understanding of the facts of Russian history and present-day reality."[6] Karl Popper thought the maxim expressed the relativist's irrationalist "doctrine of the impossibility of mutual understanding between different cultures, generations, or historical periods – even within science, even within physics": "The myth of the framework is clearly the same as the doctrine that one cannot rationally discuss anything that is fundamental, or that a rational discussion of principles is impossible
d7fb5c No.2249887
>>2249884
i will be personally interested to see what post #111 will be
35d493 No.2249889
>>2249853
>>2249841
confirmed. Only the top 3 links from 7-3-2018 work now.
This is sounding like database corruption to me. Possibly from the catalog injection from early July?
09138b No.2249890
>>2249863
what's your site?
408ac7 No.2249891
and then Shia and Kanye exposed Hollywood…
it's so obvious now.
f814b7 No.2249892
4fd2d2 No.2249893
>>2249869
and in light of that question, ask how are bread links from much earlier, in June, still active?
like this one - https://8ch.net/qresearch/res/1794589.html#1794676
09138b No.2249896
>>2249884
Is your crystal ball working again?
fa085a No.2249897
>>2249869
The Jew has devoted a huge amount of computing man power and AI power to cleaning up (((their))) mistakes.
It is too late for that shit.
Scream at the sky all you want. Your kind is finished here.
2e9175 No.2249898
>>2249802
Ty anon, perfect.
This is what I was hoping last night
someone would come up with.
I'll prolly >>2249802
bake the next 2 breads.
So if I screw up OP formats next one,
we can fine-tune by morning.
Since we can't fit these on one line,
what do you guys think about this formatting?
Wednesday 07.04.18
>>2029255 —————————————————
>do we not have a link for this one?
Independence Celebration
Tuesday 07.03.18
>>2022737 https://8ch.net/qresearch/res/2022006.html#2022737
rt >>2022584 https://8ch.net/qresearch/res/2022006.html#2022584
Who do you see?
>>202258 4https://8ch.net/qresearch/res/2022006.html#2022584
United 747 (Retired) Through Blinds at SFO Global First Lounge
>>2022398 https://8ch.net/qresearch/res/2022006.html#2022398
rt >>2022233 https://8ch.net/qresearch/res/2022006.html#2022233
Trolling is Fun. Hussein/Trump interior = identical minus small changes.
>>2021248 https://8ch.net/qresearch/res/2020479.html#2021248
rt >>2019981 https://8ch.net/qresearch/res/2019727.html#2019981,
>>2021248 https://8ch.net/qresearch/res/2020479.html#2021248,
>>2020544 https://8ch.net/qresearch/res/2020479.html#2020544
Do 'reflections' violate NAT SEC rules?
>>2018075 https://8ch.net/qresearch/res/2017360.html#2018075
Divide they try. Fail they will.
>>2017327 https://8ch.net/qresearch/res/2016598.html#2017327
rt >>2016766 https://8ch.net/qresearch/res/2016598.html#2016766
WelcomeAboard.png (Picture from inside AF1)
>>2014318 https://8ch.net/qresearch/res/2014292.html#2014318
Add another to the list
>>2014158 https://8ch.net/qresearch/res/2013512.html#2014158
rt >>2013625 https://8ch.net/qresearch/res/2013512.html#2013625
Matters of National Security
7d0147 No.2249899
>>2249884
What makes you think that?
4fd2d2 No.2249900
>>2249884
going with 23 days out, friday 27th.
will be interesting to see either way.
9564c5 No.2249901
>>2249868
if i followed through and had discipline i would have no time at all to be here.. i'm behind on so many things..
>>2249871
>>2249872
and i WANT to be here anons! i want to stay and be part of this movement and help the world plus truth is addicting
but my mission on earth also has to do with helping the world and instead of working on that i'm on here
i feel guilt either way
feel guilty and selfish when i'm away from the board and not actively redpilling
feel guilty and lazy when i'm on the board and not actively working on my own shit
i know the answer is balance but i've more so just been bouncing between extremes.. cold turkey.. and then back to addiction
i sound so pathetic rn lol ignore these shitposts
55c4f1 No.2249902
>>2249881
It was , and was covered by the MSM several days ago (or more).
This supposed to be some secret info from CDAN?
Predicting the past in cryptic fashion?
Impressive
77e319 No.2249903
>>2249895
← Think of it as a new theology.
09138b No.2249905
>>2249893
Many, many months ago I went looking for some old breads and found that they were leaving out of order.
35d493 No.2249906
>>2249898
All of those except for thread >>2022006 are now 404
9564c5 No.2249910
>>2249879
fucking shit
if that's true i'm fucked
edd710 No.2249911
>>2249902
The drugs and pedo too?
408ac7 No.2249912
patiently waiting to drop the MOAB on PEDOWOOD…
09138b No.2249913
>>2249898
I like that formatting
7f8a91 No.2249915
>>2249869
>>2249877
Yeah, even though this board got a huge upgrade not too long ago.
>>2231741 <-- anyone see this in notables recently?
or just keep blaming it on all the peeps you don't like
408ac7 No.2249916
>>2249910
Defango warned you..
4fd2d2 No.2249917
please just use the same format we have been using for months now. it's the formatting in the pic related, in that post.
>>2249898
ad01da No.2249918
In logic, reductio ad absurdum (Latin for "reduction to absurdity"; also argumentum ad absurdum, "argument to absurdity") is a form of argument which attempts either to disprove a statement by showing it inevitably leads to a ridiculous, absurd, or impractical conclusion, or to prove one by showing that if it were not true, the result would be absurd or impossible.[1][2] Traced back to classical Greek philosophy in Aristotle's Prior Analytics[2] (Greek: ἡ εἰς τὸ ἀδύνατον ἀπόδειξις 'demonstration to the impossible', 62b), this technique has been used throughout history in both formal mathematical and philosophical reasoning, as well as in debate.
The "absurd" conclusion of a reductio ad absurdum argument can take a range of forms, as these examples show:
The Earth cannot be flat; otherwise, we would find people falling off the edge.
There is no smallest positive rational number because, if there were, then it could be divided by two to get a smaller one.
09138b No.2249919
>>2249907
I hope you're right.
7d0147 No.2249920
>>2249890
https://q-questions.info/research-tool.php
It's good for TEXT. Searchable. Includes general threads since Q showed up on 4chan.
408ac7 No.2249921
>>2249915
Q's goal is to create a Hivemind consciousness to counterbalance that of Lucifer's….
af56b5 No.2249922
>>2249862
I cannot find anything that shows it was voted on yet and passed.
Several sites show it as pending
Could you post a link please?
2b6fce No.2249923
>>2249901
Every thought you are exactly where you are
needed most, at the same time realizing truth
about all things, including yourself. Truth harsh
light sometimes, but now realize, now chance
to change. Before no chance, so be
thankful, faithful, PRAY, if you would.
d7ff5f No.2249924
>>2249864
they won't bother you if you're suicidal.
1dc566 No.2249925
021485 No.2249928
>>2249922
not passed, sorry I misspoke.
"House - 06/12/2017 Referred to the House Committee on Oversight and Government Reform."
It is a dangerous bill. it should not pass.
https://www.congress.gov/bill/115th-congress/house-bill/2884
4fd2d2 No.2249929
>>2249901
45 only sleeps 4 hrs a day.
after 2 weeks you get used to it.
take a couple 20-min power naps.
each time you wake, it's like a new day.
ad01da No.2249931
Ovid, Tristia, 1.2.97: si tamen acta deos numquam mortalia fallunt, / a culpa facinus scitis abesse mea. ("Yet if mortal actions never deceive the gods, / you know that crime was absent from my fault."
09138b No.2249933
9fc0a2 No.2249934
>>2249729
Theory.
Has anyone seen the Elastic Heart video by Sia?
A LOT of people screamed over it, and I have mixed feelings, however, I think the dancer Maddie was meant to be the powerful figure, trying to rescue HIM from HIS cage.
But he's too big, grown up too much to be saved and get out to the other side.
Just a theory from a person who might understand.
af56b5 No.2249936
>>2249928
Thank you for clarifying
I've been so busy with Q research for months I thought I missed the vote
cef205 No.2249937
>>2249791
There WAS one that mentioned AIM, which anons interpreted as something like American Independence Media (?) and went down that road.
Personally, I kinda thought it was referring to the American Indian Movement, particularly in relation to the Bureau of Land Management (and the Bureau of Indian Affairs, since I thiiiiink BLM has is supposed to be the oversight.)
Anyway: BIA has been used as a slush fund forever. I think there was a pretty massive (tho little discussed) scandal a decade or so ago regarding the epic thefts by BLM. I think… May come back to that later.
9564c5 No.2249939
>>2249929
i barely slept in high school and college and it really fucked me up memory and cognition wise.. sleep is really important to me (and important for all humans living on earth rn during massive energy shifts) and my schedule has been all over the place now.. idk man
i feel like if there was some BIG action then i could step back and not feel like i have to consume every crumb but it's happening so slowly it's like i need to see the hints and crumbs and shit to keep hope alive.. dangerous cycle
140942 No.2249940
>>2249921
The critical point will be reached after certain public event, after which point the expansion will be unstoppable. We will see what happens.
d79e48 No.2249941
Hahahaha! I think I know what happened to Kanye.
According to Renegade anon he was owned by the Kardashians. Kim dosed his drinks, etc, then had him committed and took control of his life, legally, as his wife.
POTUS gave it back to him. Gave him the dirt on the Kardashians and whoever else he needed to have his strings effectively cut.
Then makes Kim stand behind POTUS in the White House!
Kek. Explains the murderous look on Kanye’s face after the meeting at Trump Tower. He didn’t want to talk.
Now he gets revenge.
d7ff5f No.2249942
>>2249869
They are not as smart as they think.
They do not understand how INFJs see. No one does. We already had it all.
09138b No.2249943
>>2249906
are any non Q threads getting 404'ed?
ad01da No.2249945
adversus solem ne loquitor do not speak against the Sun Or, "do not argue what is obviously/manifestly incorrect
408ac7 No.2249946
>>2249934
the cage symbolism is him crying for help and proof he was under hollywood's cage…
read his latest Esquire interview published in March.
he claims he was raped.
Basically, is totally over Hollywood.
And, talks like he's preparing to expose it all.
ad01da No.2249947
a falsis principiis proficisci to set forth from false principles Legal phrase; Cicero, De Finibus, 4.53
b2848d No.2249948
>>2249900
This could be too. Either way the Iran tweet heard round the world along with the FISA doc release were dam break events. Q returning from the shadows to help guide the next phase just fits.
9564c5 No.2249949
>>2249924
who, the clowns? i am not suicidal..
9f2d2e No.2249951
>>2249341 (lb)
Very sensible analysis, up until the God saves Israel stuff. For the sake of simplicity I prefer to keep things on the earthly plane, that's complicated enough. It has its place I know…
So, I would say according to 947 that Muslim Brotherhood is involved. 'Frenemies with Iran.'
Wrap your head around this matrix:
https://www.middleeasteye.net/news/iran-and-muslim-brotherhood-best-enemies-2061107490
>>2249087 (lb)
This stuff is just habbening now and that's from back in Jan! So much more to dig.
408ac7 No.2249952
ummmmm?!?
WE TOOK DOWN GUNN LAST NIGHT
AND DAN HARMON TONIGHT
WWAAAAAAAAAAAAAAAHT
4fd2d2 No.2249953
>>2249905
i was here a handful of times when new bakers fucked up the numbering but they (at least those days) quickly addressed and fixed it.
this is something funky going on because the enemy is deeply disturbed by the fact that Q is going public, new arrivals will continue to increase, our /moab/ will grow to full capacity, and they will be exposed for the evil they do.
so they want to do 3 things:
1. fuck up the organization of the breads
2. deter new arrivals by creating an air of confusion and contrarianism
3. deter oldfags by shitting up the breads to the extreme they're unbearable.
we have to be vigilant, be aware and fight to keep things as much in check as possible esp. now, and at least until BO/CM can make a formal statement, which we need to continue to ask for until we get.
wwg1wga.
d79e48 No.2249954
>>2249864
Be healthy, but first, stop making excuses faggot. Your grand daddy probably lost his eyesight from agent orange. You can squeeze in a jog whilst listening to a POTUS rally.
29a0cf No.2249955
Did we catch this yet?
https://www.theguardian.com/us-news/2018/jul/21/steve-bannon-plans-foundation-to-fuel-far-right-in-europe
408ac7 No.2249956
THE DELETENING: SELF TWITTER TWEET PURGE BY HOLLYWOOD https://archive.is/nDUBD
4fd2d2 No.2249957
>>2249939
are you rh- anon? because you just described what happens to rh- bloodtypes when they are not fulfilling their basic nutritional requirements.
ad01da No.2249961
alterius non sit qui suus esse potest let no man be another's who can be his own Final sentence from Aesop ascribed fable (see also Aesop's Fables) "The Frogs Who Desired a King" as appears in the collection commonly known as the "Anonymus Neveleti", in Fable 21B: De ranis a Iove querentibus regem). Motto of Paracelsus. Usually Attributed to Cicero
d79e48 No.2249964
>>2249901
I gave you shit on your last comment but in reality I know the feels. Not fat feels but fuckin up normal life feels. Casualties of war to some extent but also don’t make excuses (talking to myself too). There will be a payoff of sorts, but it will be in the midst of a lot of pain. When people wake up, or want to wake up, you’ll be a nice comfortable shoulder to cry on and learn from.
WWG1WGA chubby anon!
WWG1WGA!
9564c5 No.2249965
>>2249957
my blood type is A+ so i guess no?
275d61 No.2249966
It's quite obvious that now everything unfolds and makes progress like Trump on Iran, Q will post soon again or at least he has to, so he can lead us to the right direction once again. My theory is Q posts either tomorrow or friday.
7d0147 No.2249967
>>2249943
Yes. The "Quest for Searchability" thread got deleted. Computer programmers frequented that one.
55c4f1 No.2249968
>>2249961
Kiss my frog's ass
bf7538 No.2249969
>>2249956
ThanQ for the link, anon!
VERY interesting seeing who all is shitting themselves and deleting shit
ad01da No.2249970
asinus asinum fricat the jackass rubs the jackass Used to describe 2 persons who are lavishing excessive praise on one another
2b6fce No.2249971
>>2249958
Thank you, anon. whoa, i like yours also.
d7ff5f No.2249972
>>2249944
Do you think she's really a very nice person at all? Merely clueless and frightened even of her own shadow?
>>2249949
no, i didn't mean you. sorry.
f253b5 No.2249973
JULY 23RD NowC@mesTHEP@in—-23!!!
The only reason Q would be done posting is because Q's work is complete and the hammer is about to fall, meaning arrests and prosecutions will commence of Hussein, the witch, comey, et al. and the sealed indictments opened.
When it is done, Q is done. It is the moment we've all Been waiting for, The moment Q promised us would come.
The grand finale is upon us. Fasten your seatbelts and enjoy the show. ThankQ. (If im wrong, Q will return.)
9564c5 No.2249974
>>2249964
hey i'm not chubby! :(( just not as fit.. i still eat an extremely healthy diet so there's that
but YOURE RIGHT my grandparents and parents went through so much worse i need to stop being a baby.. one day they will all see why i've been a hermit..either way the work never ends! WWG1WGA <3
4fd2d2 No.2249975
>>2249965
right the + means positive.
try to stick to a variety of lean protein, the fk away from soy and whole grains and try to limit grain in any form at all… you need lean meat like chicken and fish, and a variety of fruit and veg. you need vitamin d with K2.
fe3ba6 No.2249977
>>2249829
WOW! Helpers leaving crumbs. Look at the description of the book. More about pedo stuff.
2b6fce No.2249978
>>2249958
oh actually those were found here, not sure
who made them, but i appreciate and will
spread them as much as i can. Sometimes
i change them a bit.
140942 No.2249980
>>2249973
Q did mention that the build is near complete. If it's complete, guess it would make sense that Q does not need to post anymore.
ad01da No.2249982
These fag actors will be like a banal South Park of adult child emotional appeals brought to you by tax dollars and pro ciascalps
d7ff5f No.2249983
>>2249965
A+ is THE type. Welcome to the master-race.
7d0147 No.2249984
>>2249972
Not just the UFO. The smoke looks different.
55c4f1 No.2249985
>>2249966
Maybe the Plan is rolling and he doesn't' need to come back
What do you expect from him?
Now that he has pretty much laid out a plan that will take month more to run through the phases in process.
What more do you think he needs from us. We haven't answered most of his open questions, but he has no need to.
He already know the answers, and was a favor to us to peak behind the curtain
775577 No.2249986
>>2249952
You should've seen the half-woke Anons freaking out and crying about their Muh Rick And Morty Show!!!! Oh, no!!!! Love that show!!!! Love muh mind-control programming and dumbing-down of society!!!! It was sad and pathetic.
d7ff5f No.2249987
>>2249984
"Jews with Dews".
de5528 No.2249988
Barrick Gold, Clinton's, Shoshone's and Burns Strider; 2014.
Brian Greenspun and WJC were roomies in college.
https://wikileaks.org/podesta-emails/emailid/840
140942 No.2249990
>>2249982
hey ebot, tell me a joke
09138b No.2249991
>>2249953
I'm not denying there isn't some form of fuckery going on here. I was just pointing out that before this board became public, breads did not leave in numerical order. Sometimes 50 breads were spanned. I just wondered if the only reason we are seeing it now is because Q hasn't posted in so long. Very few anons went looking for breads that were much older than a week. However, with so many breads suddenly getting a 404, there appears to be something wrong.
I agree with your other thoughts and will add the clowns who purposefully try to start a disinfo campaign to prove we are nothing more than conspiracy theorist. It's critical we stick together and fight, fight, fight.
Cheers anon.
d43587 No.2249992
I'm not sure if this is a POSSIBLE Q decode:
Revolves around the following 3 pieces of information:
1. Q post 556 with the phrase: "Make sure to learn Russian.": https://qanon.pub/?q=russian#566
2. Putin's mention of Browder recently: https://www.businessinsider.com/trump-putin-bill-browder-magnitsky-act-press-conference-2018-7
3. The recently resurfaced Magnitsky documentary. It's on bitchute. One of the relevant parts starts at 52:00 and on through the German politician's interview.
Some interesting things in the documentary, which is about the accountant who is the namesake behind the Magnitsky Act.
The official narrative is he was killed because he accused some Russian cops of stealing from Browder's interests, and they locked him up until he retracted his accusations, but held out until he died.
The EU MSM proof of this is the Russian police document which is a supposed written account or testimony and Magnitsky's accusations against the officers, and his subsequent imprisonment, and harsh treatment, which lead to his death.
According to the director, because it's in Russian, everyone (including himself) took Browder's translation of the document for granted that's what the documents say. Apparently, nobody else in western media bothered to have it translated on their own?
Long story short, the director contends that Magnitsky never named the officers of stealing directly, his proof being the same exact document, contrary to the widely spread translation of the document. (Which destroys the motive to kill him).
The connection to Q, and what might be the decode, is that in the U.S., the Act is passed, based on a *possible* FALSE TRANSLATION of said RUSSIAN "testimony". Make sure to learn Russian?
I couldn't track down the scrib document, that was a screen grab from the documentary, plus I don't speak/read Russian anyway, but thought maybe an anon could track it down and take a look at the actual testimony for themselves. That's all I got, and I could be way off, or maybe misunderstood some things in the doc though, because I know nothing about the Russian political atmosphere.
Little bonus crumb included in pic.
9564c5 No.2249994
>>2249975
i don't eat dairy meat grain/gluten soy or processed foods.. before i became addicted to Qresearch i made sure to get at least an hour of sunlight every day, usually more.. i got lots of nutrition red pills for ya but too hard for most people to swallow
and
>>2249983 whaaat i am intrigued tell me more
5714f9 No.2249995
>>2249714 (lb)
Expand Thinking
You're more important to the World/Universe than you believe.
Everything in life has Meaning.
Why else would our Mongolian brother be wearing green
Everything Connected.
Angels are real.
You like to call them Coincidences, but we call them signs.
Just because you can't see us and hear us, it does not prove we can't see you and hear you.
This is bigger than you can imagine.
Trust G, he works for the Boss upstairs and not for my brother who resides downstairs.
My wings are growing in nicely this reset, and soon yours will too.
Have faith
Gift is for (you) Anon >>2249714 (lb)
G has multiple meanings
GOD, Geometry, Green, Grandma, G=7, Gift
Why did Native's perform a rain dance?
Why would Native's teach children the rain dance generation after generation if it were a LARP.
All that Rain Dancing from Natives on multiple continents has meaning.
Think Logically.
Why?
Watch the Water.
These people are stupid.
Comey Comey Comey
A farm bill, Farmers, Farming.
Timing is crucial
^Take the last 5 lines and ask yourself why is Comey standing in a cornfield like he's lost and confused.
Pray for the Good People in the Middle East and………. MAKE IT RAIN
READ THE BIBLE
GOD WINS
G
408ac7 No.2249996
https://www.highsnobiety.com/p/aaron-bondaroff-sexual-misconduct-allegations/
Aaron Bondaroff Steps Down From Know Wave Following Accusations of Sexual Misconduct
09138b No.2249997
ad01da No.2249998
As well you should know
This stupid cia experiment
Those fucking murderpus crack dealer memes you call politicians
Leaves little room for apothogy
~serial smasher
408ac7 No.2249999
UPDATE: Aaron Bondaroff has now stepped down from Know Wave following allegations of sexual misconduct. After the news broke yesterday, Bondaroff announced that he resigned from his co-founded gallery, Moran Bondaroff.
55c4f1 No.2250000
>>2249973
Dream on, That has months to run.
This isn't a move that runs a fixed amount of time
ad01da No.2250002
And you can shove your stupid homo payops through s juicer
97f478 No.2250003
fa085a No.2250004
>>2249986
Your a fucking shill. Rick and Morty is a show that is redpilling the youth of America. The Jew is trying to take it out. You watch the episode where they have a presidental election and they beg the new president to destroy everyone who tries to keep the old order? You see the first episode of season 3 where they show you a currency reset?
You Jews are moronic. You will not win this battle. Dan Harmon is no kid fucker. He was showing the insanity of the kid fuckers.
Yuck it up now kikes….your day is coming fast.
fe3ba6 No.2250006
>>2249882
>>2249882
"…a range of grades are available including Mil Spec (military grade),…"
Perhaps related to compromising our Mil equip with China? Maybe its about that deal. We already know that it was happening. Just a coincidence there.
7d0147 No.2250007
>>2249999
Who's putting the pressure on these people? I can think of a company where this needs to happen.
09138b No.2250008
>>2249967
hmmm….looking like we have another problem with the catalog. Wish BO was around.
7d0147 No.2250009
>>2250008
To be fair, it was an older thread, and it wasn't getting posted to much toward the end.
9564c5 No.2250010
>>2250008
BO can't do anything.. only CM can
d79e48 No.2250011
>>2249974
Your estrogen is showing anon, kek. I don’t know of the best serious advice to give you except remind yourself of the scale of the issue at hand.
We are saving the world. And all the little kids. And all the people that live as slaves. This is something to be proud of.
Another thing…. It will never end. There will always be evil waiting to take advantage of someone. There will always be work to do. Part of what hanging around here will get you is a cold heart. Or at least a walled off place in your heart that holds the knowledge of the continual horrors that go on in the world. I couldn’t imagine what it’s like to be a high empathy person learning this stuff. I can compartmentalize, it got me through my childhood, helps me survive here.
Guilt slows you down anon. You sound like a patriot, you should feel pride. Sacrifices have to be made in war.
“The worst guilt is to accept an unearned guilt.” - Ayn Rand
fe3ba6 No.2250013
>>2250010
>>2250010
What was in the breads they scrapped? Something was posted (((they))) didnt like.
9564c5 No.2250014
>>2249996
holy shit.. more heads rolling bc of this guy's drops..
09138b No.2250015
>>2250009
oh, well maybe that was just normal then?
>>2250010
BO would probably have better luck getting thru to CM
9564c5 No.2250016
>>2250013
that's what we need to find out
ae7b0b No.2250018
ERBIL, Iraq (Reuters) - Gunmen entered the governorate building in Erbil, the seat of the Kurdistan Regional Government (KRG) in northern Iraq on Monday, and fired from windows at security forces, a deputy governor of the city and Kurdish security officials said.
https://www.reuters.com/article/us-iraq-kurds-attack/gunmen-open-fire-and-enter-erbil-governorate-building-in-iraqs-kurdish-region-officials-idUSKBN1KD0MF?utm_source=twitter&utm_medium=Social
2b6fce No.2250019
>>2249995
dam bro, your spo_ky in a GOOD way.
Careful your sway, if you are a larp, can do
much damage larping to GOOD spirits. They
can be broken by hope lost reset. If real, be
real, and Godspeed.
5da43b No.2250020
>>2250013
Future proves past.
d79e48 No.2250021
>>2250004
You may be right. They prob had some counter shots ready to go. This one was at the top of their list. We took down their guy, they muddy the waters with this.
Or they’re both sick fucks. Not sure yet.
e9b66c No.2250022
>>2249957
rh negatives represent!
sidenote:
haplogroup Q represent!
Remember that dna-string on the back of Trumps speech paper that one time? ;)
https://www.eupedia.com/europe/Haplogroup_Q_Y-DNA.shtml
2b6fce No.2250024
>>2249995
i didn't even realize that was Comeyx3 looking
at a corn field. Why is he lost and confused.
What's he looking at? i can PRAY for the GOOD
People in the Middle East.
d79e48 No.2250025
>>2250016
Someone has it all.
4fd2d2 No.2250026
275d61 No.2250027
>>2249992
Nice catch, anon!
d7ff5f No.2250028
>>2249983
anon we are one species (almost). one body many members. i'm happy i exist, 100% contingent being and a sinner, but with a divinized future to lay hold of. top kek.
d79e48 No.2250029
7d0147 No.2250030
>>2250026
Don't delete stuff from the header just because it's 404 now. It's still useful to me if I've saved the thread already.
3a905a No.2250031
Just returned. What's this I'm seeing about deleted breads/posts/broken catalog? Can anyone give me a quick rundown? Still catching up.
140942 No.2250032
>>2250002
where's the joke?
0b0084 No.2250033
>>2249973
The "Plan to Save the World" video states that Q will return to help keep us informed once the "war breaks out onto the surface".
I think there's still some time before that kind of stuff (Octoberish).
IN the meantime we have the FISA and OIG reports to get unredacted somehow..
e9b66c No.2250034
YouTube embed. Click thumbnail to play.
>>2249995
I think you might appreciate this
2e9175 No.2250036
>>2249777
Never doubted
>>2249718 lb
>we need standard protocol, which all bakers are bound to follow
I agree, but it has to come organically, transparently, voluntarily, by consensus, and leave a wide latitude for interpretation or autists won't thrive. We need to recruit more autist bakers (LOOKING AT YOU FAGGOTS) and then hash this stuff out a bit more
>>2249808
>Since there are negligible rules here there is negligible responsibility
Incorrect. It's just that the responsibility is entirely subjectively motivated, no outside authority. Some ppl have higher standards and sense of duty than others. The key to organizing groups of independent thinkers is recognition of proven work product, open for all to see, and the freedom to do that work with minimal interference. This is why Q came here. Autist consensus will decide what/who they want. It's been working well, we don't want to break it. Just buttress as needed to withstand greater stress test of shills and normies.
7d0147 No.2250037
>>2250030
Actually, it's still useful even if I have to go hunt down the threads on the archive sites.
09138b No.2250038
For anons thinking Q won't be coming back.
Jan 23, Q states his last post will self destruct.
We haven't seen that yet. There was another post that I can't find right now, (too tired) that also alluded to more to come.
fe3ba6 No.2250039
>>2249995
>>2249995
That picture was def comms. They are moving away from words because we are all onto them. They are using regular weird pics, now.
4fd2d2 No.2250041
>>2250030
exactly.
look at the perfect example of how it used to be: see all that green? those are all archived. no reason to change previous protocol.
1556b1 No.2250042
>>2249967
>>2250010
>>2250008
if the thread is not locked to the board, then after awhile it will fall off.
The same thing happened to advanced memes thread. We made another one, and BO locked it.
I imagine that was what happened. If you make a thread, that you think is important, need to have BO lock it, or it will fall off the board into archives.
9504c2 No.2250043
plan to take down pedowood
1. go to every famous actor/actresses social media accounts (facebook/twitter/myspace etc..)
2. find at least 1 post containing pedophilia
3. get friends to retweet the posts and give the pedos the hook
7d0147 No.2250044
>>2249777
Not sure pedogate is a distraction. Aren't a lot of those sealed indictments supposed to be related to that?
2b6fce No.2250045
>>2249995
Water the plants?
ff4d0f No.2250046
>>2250022
What does a haplogroup Q signify?
140942 No.2250047
>>2250038
What kind of self destruction will it be like?
09138b No.2250048
>>2250031
recent breads are 404 when older breads are not
9f2d2e No.2250049
>>2250004
I got that from his video too; lampooning the current state of what passes for comedy. He could also have been signaling what he knows is going on.
Very very bad taste though and unfortunately might not be recoverable.
9564c5 No.2250050
>>2250011
oops shh..
and thank you for these words, anon. i really needed the reminder.. the work never ends but i do believe when most of the filth of this planet is removed, we have golden days ahead of us.. i'm high empathy but i am (usually) able to mentally abstract the truth so much that it loses most of its sting..
100,000ft view
but you're right.. this is war and i am proud to be here fighting alongside patriots. amazing times we're living in..
7d0147 No.2250051
>>2250042
If I think it's important, I'll archive it and add it to my database. I have that thread.
ab5b87 No.2250052
I missed this…different time zone.
When POTUS learns your comms!
I like the way he did this. NK/China/Iran…they all use the same 'mother of all empty threats'. Posturing/bluff/maintain their image.
Anyway; I agree with earlier posts, it seems to be playing out like NK.
d79e48 No.2250053
>>2250031
I think it may be a slide but here are links from last bread.
>>2249400
>>2248901
4fd2d2 No.2250055
>>2250031
the 7/4 Q-drop bread is 404
thenceforth, bakers decided to stop posting any of the Q-drop breads at tops of bread, and instead posted highlighted, old, q-drops.
we are looking for clarity regarding 2 things:
1. why the newer breads are gone
2. why the formatting of breads suddenly changed to not even show the archived Q-breads
see
>>2249802
>>2250026
and THANK-Q!!
7d0147 No.2250056
>>2250031
Well, Q's last post is missing, among others. It was from July 4, so not all that long ago.
09138b No.2250057
>>2250047
my guess is it will be something that can't be denied by (((them))) and may take down this board, 8ch or even the internet.
1556b1 No.2250058
>>2250043
some are deleting their old tweets, as if that will save them, kek
nothing is ever really erased.
THESE PEOPLE ARE STUPID
7d0147 No.2250060
>>2250058
They don't know about archive.org, do they? I've recovered tweets from there before.
9504c2 No.2250061
>>2250058
check myspace then…
who knows what could be on there?
4fd2d2 No.2250062
>>2250031
note - anons had to beg thru multiple breads to even get an acknowledgement of the problem, and have been begging ever since, for a better solution… we need your help BO. TY and God bless BO.
de5528 No.2250063
>>2249988
The Greenspuns & blurb on WJC connection.
Thanks MSNBC!
What Hillary Clinton’s $225,000 speaking fee buys you
10/14/14 09:50 AM—Updated 10/14/14 01:50 PM
By Alex Seitz-Wald
A summer dominated by concern about Hillary Clinton’s wealth has given way to a more friendly autumn. But questions about her finances returned to the headlines Monday night, because of a paid speech she gave to a school in Las Vegas.
The keynote speech to the University of Las Vegas Foundation’s annual dinner became controversial in July when students said they wanted funds put towards student aid, instead of Clinton’s $225,000 speaking fee.
Republicans sought to revive the issue Monday, sending out an email to reporters slamming “Clinton’s Nevada Pay Day.” Much of the local news coverage of the event included reference to the payment and the controversy. (Clinton donated the speaking fee to her family’s charitable foundation.)
So what did the university get for it’s money?
Clinton helped helped raise $350,000 (minus her $225,000 speaking fee) by selling out the event at the Bellagio, where tickets for the 900 guests went for up to $3,000. Here’s what else they got:
2016 flirtation: Anyone seeing Clinton speak is hoping for some insight on her 2016 plans, and she is usually happy to deliver.
In Las Vegas, there were new euphemisms for “that other thing,” as Clinton called a potential presidential run in Iowa.
Before beginning the Q&A portion of the event, moderator Brian Greenspun handed Clinton a pair of Nikes, which he made sure to point out were “running shoes.” Greenspun is the publisher of the Las Vegas Sun and a UNLV trustee, but before that he was Bill Clinton’s college roommate…
https://www.msnbc.com/msnbc/hillary-clinton-what-225000-and-pair-nikes-buys-you
fa085a No.2250064
>>2250021
check out the Rick and Morty episode where they show King Jelly Bean, a leader of a medevial area that lures Morty into a bathroom and tries to rape him in a bathroom, Morty comes out crying and Rick figures out what is going on, plays it cool and then shoots King Jellybean and blows him up. It is an extreme anti-pedophile episode. It's the Meseeks and Destroy epsiode Season 1 Episode 5.
his channel 101 show was a mini video film fest that went on each week, where they did creative and very non mainstream videos, often making fun of the news of the week, which might have included a politician or someone in the news who had raped a baby so it may have been an attack on something liek that, but these were low budget and cheap and so the context is lost in this lone clip. Harmon's Rick and Morty is a red pill show that flew under the radar because they were 'loser animation on adult swim, nothing to worry about there', but now that it came on their radar, they are looking to take people down. dont be fooled.
b39e8e No.2250065
>>2250056
Did it self destruct?>>2250038
d79e48 No.2250067
>>2250050
WWG1WGA!
I look forward to the future, I hope it is as you see it. I tend to agree with you.
3a905a No.2250068
I'm not seeing any thread deletions so I'mma ask the monkey.
7d0147 No.2250069
>>2250065
No idea. Only CodeMonkey would know for sure.
e9b66c No.2250070
>>2250046
It's a Y-cromosomal (patrilineal) dna group.
>The technical details of M242 are:
Nucleotide change: C to T
Position (base pair): 180
Total size (base pairs): 366
Forward 5′→ 3′: aactcttgataaaccgtgctg
Reverse 5′→ 3′: tccaatctcaattcatgcctc
https://www.eupedia.com/europe/Haplogroup_Q_Y-DNA.shtml
If you're interested in more, feel free to search for it? :)
fa085a No.2250072
>>2250049
It is recoverable….Rick and Morty is OUR show. Dan is a warrior.
4fd2d2 No.2250073
>>2250068
>Board Owner
thank-Q
can we please have the subsequent breads formatted in the same manner they always have been, with a note regarding the 404 Q-breads?
we badly need this.
1a7199 No.2250074
>>2249901
Find a balance for Christ sake. Do you have NO CONTROL at all over yourself?
021485 No.2250075
>>2250031
Shills sliding. Nothing moar.
7d0147 No.2250076
>>2250073
Agreed. Post the breads as if nothing changed. They're still useful to those who archive.
bf7538 No.2250077
>>2250072
Time will surely tell
02d042 No.2250078
>>2250038
It self-destructed. The LAST POST from 7/4 has been deleted.
4fd2d2 No.2250079
879980 No.2250080
Hey anons we're having a really interesting and possibly huge conversation on 8chan pol about some water issues a few anons discovered happening around America. This may be very big and very related to "watch the water" as it does make sense what they are saying but they need people from different areas to confirm things. You guys should at least look at it as this looks very big from what they are writing. Conversation got sidetracked to water about halfway down so just go to bottom and up a bit and it's all about it.
https://8ch.net/pol/res/11895442.html
1556b1 No.2250081
>>2250071
the inspiration for the code monkey badge,,
monkey help us, kek
3a905a No.2250082
>>2250075
If there is an issue with the board, I'm not going to ignore it.
Fuck you.
275d61 No.2250083
>>2250068
Bread was deleted from July 4th, you can check it on qanon.pub
Others said it were archives, however some older breads, even older than June are still active, so that doesn't make really sense. I still believe someone deleted them.
ff4d0f No.2250084
55c4f1 No.2250085
>>2250057
R.E.M. - It's The End Of The World
https://www.youtube.com/watch?v=Z0GFRcFm-aY
No one in the outside world gives two shits about this board (except the amateurs shills) No on is gonna waste any AI horsepower, or 3-letter agency professionals UNLESS Q is here. Otherwise, the will let this board melt down like all of them do, for all the same reasons
We aren't essential to the Plan - Deal with it
It is happening out in the real work without us
Open your eyes and use a little logic -
8 chan is NOT going to save the world - grow up
4fd2d2 No.2250086
look how the massive shilling basically just shuts right down when BO arrives.
09138b No.2250087
>>2250078
Nothing has been deleted.
1556b1 No.2250088
>>2250068
was the board locked? did it fall off into archives, like the advanced memes thread did?
2e9175 No.2250089
>>2249861
kek!
>>2249856
TY baker.
I'll prolly be good till 8/9 ET
but if you wanna bake
lemme know
especially if you are a…
NEW(ISH) BAKER?
d79e48 No.2250091
>>2250064
I’ve seen some of it and loved it. The science they reference is usually spot on with what I know, always gave me the nerd feels.
My pedo guard is up high. I guess that makes me vulnerable to cabal psycho-judo.
I will investigate further thank you.
bf7538 No.2250092
>>2250081
Every time somebody mentions codemonkey, I hear that in my head
021485 No.2250093
>>2250082
You are finally awake.
09138b No.2250094
>>2250085
I don't believe I made any of those claims. Any other reason why you attack me so?
32a6df No.2250095
Question
This Post from a few days ago 18 July
https://8ch.net/qresearch/res/2196090.html#q2196900
>>2196900
Sounds like Q
Check the thread for more
879980 No.2250096
>>2250082
Hey BO, seriously, I think this may be the "watch the water" thing. You may want to look at it too. It seems very plausible.
140942 No.2250098
>>2250093
The Great Awakening.
fa085a No.2250099
>>2250077
Yes it will. In time.
Rick and Morty was the highest rated comedy on Cable. Comedy Central did not try hard to resign him at first….they fucked around. Story was they were not going to resign it. But it would of looked insane to dump the most popular show on TV.
Dan has been fighting these assholes for years.
d79e48 No.2250100
>>2250082
Fuck em BO. Fuck em. They try every day.
e7ef81 No.2250101
>>2250000
Not saying it will be done overnight but that the hammer is about to fall.
Sure it will take time to prosecute everyone involved but something significant is going to happen to start things moving, wake up the sleepers and give up wakers peace.
55c4f1 No.2250102
>>2249861
People desperate to be noticed - next they will send him selfies
de5528 No.2250104
>>2249988
Hank Greenspun, Brian's father; colorful chap.
https://www.israellobby.org/greenspun/
G'nite…
9992d4 No.2250105
>>2250099
Take ya TV entertainment bullshit and stick it up your arse. This is Q research not TVweek.
fa085a No.2250106
>>2250085
LOL. They are all here right now. Mossad, CIA, MI6, the Jesuits.
We are the straw that stirs the drink. Q came to us. Potus talks to us.
YOU talk to us.
3a905a No.2250107
>>2250088
Well what happens often (And I see it happen on /pol/ alot) is that old breads get bumped up back to the top of the board, while at the same time, garbass ass threads are created that slide the good breads off of the catalog. That could be what happened. I think the board archives update on the first week of every month. I shot CM a message so I'll wait for his response.
4fd2d2 No.2250108
>>2250100
Amen.
God bless BO.
Always pray for BO.
d79e48 No.2250109
>>2250099
Possible both a little true? Maybe he’s comped in some other way, blackmail stuff, which explains him dipping on the twat the way he did. But if we laid the cards down and ordered them after this is all said and done he’d be on the hookers and blow side and not the ritual sacrifice one.
If he’s red pilling like you’re saying he is he’d have to have a source.
55c4f1 No.2250110
>>2250100
Make it clear you aren't their bitch
Make them clean their rooms and take out the trash before their Q comes home
fa085a No.2250111
>>2250105
Your a shill if you think TV is entertainment. TV is societal war. The Jew is trying to take down OUR biggest redpill show.
bf7538 No.2250112
>>2250105
In case you havent noticed, its all interconnected dumbfuck
4fd2d2 No.2250113
>>2250107
Could we please have the breads formatted in the usual manner, like they used to be, regardless of the breads being in archive or not, like we always have,.. with a notice about the missing recent Q-breads ?
879980 No.2250114
>>2250107
If it turns out that you are missing threads just post which ones are gone, I have every single thread archived offline up to today so I can easily just send or post whatever is missing to fill in the gaps.
7d0147 No.2250115
>>2250104
Thank you.
= Notable? =
55c4f1 No.2250116
>>2250111
The Mossad called and wanted your address.
I gave it to them
02d042 No.2250117
9f2d2e No.2250118
>>2250106
They're probably shilling each other without realizing it kek
a45d00 No.2250119
>>2250100
Been lurking because I am using an old computer and it is giving me fts. In between that and phonefagging I have caught bits and pieces of threads throughout the last several hours.
I think I finally got this one straightened out. That whole time, I saw a huge amount of concernfagging and sliding about Muh Bread and some asshole jumping BO's shit.
I just want to say
SHUT THE FUCK UP
to that asshole if he is still around.
Whiny fuckin' cunt
021485 No.2250121
>>2250082
You wanna address the problem with your BVs? AFLB was not the only Clown on your staff. The David Duke crowd has been getting a little toor lippy.
9564c5 No.2250123
fa085a No.2250124
>>2250091
Yes….(((they))) think all their attacks out in detail. They are using our own desires to stop pedos to clowd our thinking and encourage us to attack our own people.
It is basically what they tried on Trump with the METOO movement. Set up some big wig Jews to take the fall and seemingly create momentum to fire and prosecute women abusers. All leading up to the press conference where they stood up there and tried to bring Trump down. It was lies and it failed.
They are trying this attack against Dan Harmon as a mini version of that.
b39e8e No.2250125
Friendly reminder to anons
Cousin anon was a prepper, chem trail believer, rabid Pro-Trumper and a bit edgy / paranoid…
Couldn’t balance the stress of waiting…
Killed his wife, then himself yesterday.
Young kids left.
Very very sad….
PLEASE take time to breathe, pray or ground yourselves anons….
Waiting is part of The Plan
db8007 No.2250127
>>2250118
I have witnessed this happen before actually..ever attempt to take 2 bots and make em trigger each other kek
7d0147 No.2250128
>>2250114
I have them, too. That isn't the point. Maybe we need to lock any thread where Q posts, at least for a time?
e7ef81 No.2250129
>>2250033
Good to know. Would be wonderful if Q does keep us apprised of progress being made. I've been feeling like a widow not having him around.
55c4f1 No.2250132
>>2250112
What channel do get that show on in the Cosmic Consciousness.
It is all connected so it must be like the Internet.
Can the Cosmic Consciousnesses be hacked too?
How about hijackers on the Draco ships?
They have any Space Marshalls
6ce73a No.2250133
>>2249864
prophecy comes true, anon
but the ride never ends
b24ad7 No.2250134
>>2249864
You don't realize how deep in it you are until you try to leave. Watch what happens to everybody around you.
>>2249998
Go back to your masturbation fantasies.
97fd77 No.2250135
Hey guys and gals,
Someone said Sara Silverman posted in here like a "stand down" in here…Anyone got sauce or update???
2e9175 No.2250137
>>2249829, >2249829, >>2249892. >>2249925, >>2249977
Yeah but I can't sauce it. When I try it, just links to twitter. So can't tell whether larp.
>>2249864
>am probably on some clown hit list
yeah but see, chicks dig that shit
try bench-presses btwn shitposts
>>2249901
{secretly thankful anons can't see baker's unkempt surrounds}
world-saving has a way of shifting priorities, kek
2b6fce No.2250138
>>2250135
https://www.neonrevolt.com/2018/07/22/hollywoodrenegades-how-hollywood-insiders-are-taking-down-thecabal-from-the-inside-out-hollyweird-greatawakening/
97fd77 No.2250139
>>2250138
>https://www.neonrevolt.com/2018/07/22/hollywoodrenegades-how-hollywood-insiders-are-taking-down-thecabal-from-the-inside-out-hollyweird-greatawakening/
Thanks
fa085a No.2250140
>>2250109
Yes he likely has a pretty high up source. Justin Roland is a true conspiracy guy. Very up on the way the world works. Dan kind of acts like he just goes along with Justin but does not quite believe. I think that is an act to avoid too much Jew attention. Justin stopped making his podcast for a while because he was afraid people would figure out what they really thought and be vindictive….the Jews never forget. Look at Iraq and Russia. They attack them hundreds of years later for some damn Jewish afront.
879980 No.2250141
>>2250128
Not sure, I am a bit hardcore about my opinions on this subject and if I had it my way I would ban anyone who gets off topic, obviously the shills/larps when the track record shows pattern but I would also ban stupid questions and stupid statements as they fill too much of the threads up. So I am probably not the best person to ask on that.
fcfa75 No.2250142
>>2250121
>>2250123
(((muh david duke)))
YOUR (((kind))) provokes, derails, shills this board to oblivion with "muh third temple restoration" and have the FUCKING MOUTH to (((bitch)))?
Fuck off to israel roth state where your TRUE loyalty belongs, [[[shills]]].
US is NOT a jewish country. Get that through to your treasonous heads.
YOU killed JFK through your jewish bullshit, YOU collaborate on RACIAL level with pedos, sandnigger rapist scum, bring chaos to the world and OPENLY declare your "choseness"
Now you badger BO while lying and sliding to newbies about him being a shill.
The ONLY (((racist))) we need to get rid of is YOU and your fucking projecting cabal pawn buddies.
FUCK. OFF. (((SHILL))). Your times here is OVER. We know ALL your [[[TRICKS]]
55c4f1 No.2250143
>>2250129
Is is all over the news, but it doesn't make it's way into the bubble here.
No assigned news copiers
0b0084 No.2250144
>>2249864
Anon, it'll all be over soon.
You can't leave right before things start to get fun. You put in all this time and energy during the preparations, and now the show is about to start.
WATCH THE SHOW WITH US ANON
DONT LEAVE NOW
HODL THE LINE
de5528 No.2250145
>>2250107
Going on 9 months…
Best Shift!!!
G'nite…
9992d4 No.2250146
7d0147 No.2250148
>>2250134
One of the things I've done during the Q lull is prepare to return to my previous way of life. Given the bulk of the data, I'll probably be doing something with it for quite a while. But I can balance things better. But for now, it feels to me like a calling to work with the data generated here. Eventually, I'll turn it into the type of blog a normie could access. The beginnings of that are already available.
1a7199 No.2250149
>>2250125
I have transformed into some kind of vagrant looking homeless guy thats mean to everyone now. Not blaming Q blaming the fact I know and no one else gives a fuck. Def stressful . Sorry to hear about a family broken , this is war no matter how many say we are just internet addicts or whatever. The waiting is because of the clock and the plan. Simple to get to this conclusion. This evil has killed another 2 people it sounds like. Q will finish this with the heavy lifting soon I hope.
021485 No.2250151
>>2250142
BO. MY POINT.
These fuckinig SJWs hijack every fucking bread with [their] CIA David Duke Paid PROPAGANDA.
If anyone disagrees (in any way shape or form, they are a KIKE)
They spam the same half truths, lies and utterly stupid historical bullshit, in every bread.
b24ad7 No.2250152
>>2250148
Wait until they lure you into public, put you on camera, and try to break you. They have been studying you for quite a long time now.
021485 No.2250153
>>2250151
BO, and this is shit your BVs and approved bakers are guilty of.
7d0147 No.2250154
>>2250149
This type of war won't be won by letting your attitude sour.
021485 No.2250155
In those days the people of Judah will join the people of Israel, and together they will come from a northern land to the land I gave your ancestors as an inheritance.
5da43b No.2250157
They tried to make the Minute Men
But had already made the men minute
7d0147 No.2250158
>>2250152
Kinda hard to do that with someone who prefers a hermit life.
5714f9 No.2250159
>>2250019
Trust what your heart/soul tells you and ask yourself what side is winning.
POTUS was chosen for a reason.
JA was chosen for a reason.
Q was chosen for a reason.
SR was chosen for a reason.
8-chan was chosen for a reason.
G was chosen for a reason.
Dennis Rodman was chosen for a reason.
Autist's too were chosen for a reason.
(you) were chosen for a reason.
General Mattis was chosen because he can choke the enemy without using his hands.
Trust the Plan goes back further than you think.
I pray every day for those who can't see the LIGHT and work very hard to show them the LIGHT.
TRUTH brings LIGHT.
KEEP FIGHTING and IGNORE THE SHILLS.
GOODNIGHT AND GOD BLESS ALL YOU ANGELS, YOU ARE NOT ALONE.
G
1556b1 No.2250160
>>2250112
>>2250105
Over decades the general population, likes, loves, admires many people they see on tv.
They relate to the characters they play, and think they are good people.
We all thought many of them were good.
One thing many of us anons have had to come to terms with, is the people we have watched and loved since our childhoods, are all evil, sick, cruel, twisted monsters.
Hollywood stars are doing everything to lie, manipulate, and hide the truth from the people.
Many people listen to their idols. Many think they are reflections of the people they play.
These are the people screaming the loudest against Trump anmd all good progress.
These are the people who have been manipulating everyone, and corrupting people.
They need to be exposed, people need to start waking up, and seeing them for what they are.
Having the tangible tweets, and pics, etc, helps now , with red pilling, before the arrests come.
Anons discovered James Gunns tweets, look at what that lead to. Disney fired him, and alot of normies got a tiny taste of what people in hollywood are really like. So when the arrests comes, and that evidence comes out, they will be prepared, and better able to accept it.
Proabably the same numbers as congress, upwards of 70% or more of the people in hollywood, and music, are a part of the cult/club.
And A list stars, are, i imagine around 95 to 99%
97fd77 No.2250161
>>2250138
So, what board did she allegedly post this to? qresearch? and it is the funniest thing I have ever heard!! "Some of you aren't as anonymous as you think!" No kidding! Exposing the truth is number 1 priority. Anonymity is a secondary priority. There are millions of eyes on this board. Millions of people who are learning the truth. This is the begginning of something great anons. You should all be proud of the work you have done. I know I am.
But, Sarah Silverman is not posting threats here? Right? She would have to be crazy…
021485 No.2250162
>>2250156
Try as hard as you can. You can not stop TRUTH.
b39e8e No.2250163
b24ad7 No.2250164
>>2250158
Have fun with the directed energy weapons and internet failures.
d79e48 No.2250165
>>2250119
My filter goes something like this.
Simple shill shit posts to trigger us. Just scroll.
Advances shill concernfags. This will always work to some degree, momentarily. Sound like an anon and play off of inexperience of new fags. Easy to spot most of the time when rebuttals are made and response is shilly.
Human pieces of scum do the back and forth shill. They engage and with each other and have a retarded conversation in which the idiot usually convinces the more reasonable person challenging them. Or one of a multitude of retarded mixes of truths and dog shit. The key to spotting these is identifying contradictions in competency. In other words, given that they sound anon enough to get point A, they ought to know point B. And they usually move in small groups. They think we give a fuck that their friend thinks they’re right.
Anyway rant over, bed time.
e54c24 No.2250166
>>2250142
Division shilling 101 here. At least you are not spamming repetitive low level copypasta like your friends from the other breads.
"Blah blah blah jews".
There is a problem with certain ellites who are jewish and wirh the religious jewish attitude of the chosen people. But using identity group politics chases away those jews who dont follow the ideology you go against and makes you and the board sound nazi to them and to normies.
1a7199 No.2250167
>>2250154
I know I keep my patience as high as I can . Its difficult when you walk from the garage into the home and its sesame street level mentality and dealing with children both adults and the real thing. Walk back out into the garage and its world war. I am adjusting and was being a bit dramatic. I try to be nice to as many people as I can but it has gotten less as the normies hate my president so I assume almost all are against him. I yell out TRUMP in public and the white men hang their heads in shame and turn the backs on me. Sickening.
7982b5 No.2250169
>>2250168
MSNBC Wants #Qanon "Conspiracy Theory" BANNED
d79e48 No.2250170
>>2250119
Also kek. Me too.
fcfa75 No.2250171
>>2250151
>SJWs
>seriously believing this shit
>double posts to 'support' and forgets to chang IP
That's some fucking kike level pretzel retardation.
You stupid fucks are singled out for a reason you dumb motherfucking cunts.
Do you see ANY other group doing this?
ANY?
YEA WE FUCKING KNOW THERE ARE MUZZIES trying to larp.
We can pick em out easier than you can.
YOU fucking badger BO, YOU bitch about notables trying to prune them, YOU manipulate those like AFLB and try to ruin like you shill and slide comment boards all across media platforms and online networks.
YOU fucking collaborate with MSM to push angles here, you fucking treasonous whores.
FUCK. OFF. (((CUNT)))
7d0147 No.2250172
>>2250167
Are you in CA, too?
9992d4 No.2250173
>>2250160
Tell me something I don't know.
021485 No.2250174
>>2250171
You think POTUS is on your side in this…. Go find the nearest doorknob.
0f7948 No.2250176
>>2250160
Funny that you post these pictures. I was reading an old blind blog on crazy days and nights about the O'rourke girl a few hours ago.
fe9082 No.2250177
>>2250161
Fake and gay. Look at the day/date on the phone. Photoshopped for sure. (Sunday July 21… now go check a calendar; phones don't get this kind of thing wrong).
e54c24 No.2250178
>>2250171
How many more posts you need to do before the daily bonus in the paycheck?
b1a37b No.2250179
2e9175 No.2250180
>>2249953
Can't speak to point 1, don't know history.
But these are true. Coordinated:
>2. deter new arrivals by creating an air of confusion and contrarianism
>3. deter oldfags by shitting up the breads to the extreme they're unbearable.
Night Crew still has cleanest comms, but they tried pretty hard earlier this week to fuck that up. Many of you have been putting time in days calling out fuckery, is a good thing. Shaking the hornet's nest.
Keep up the good work.
>we have to be vigilant
Always. It's the only way.
Enemy never sleeps.
Adapts. Counters.
Good thing we're better at it, kek
9564c5 No.2250181
>>2250133
anon i am still plenty anonymous…
this post scares me lol
>>2250134
i know.. already experiencing that.. i tried to wake them up but they rather enjoy being asleep
>>2250137
not worried about chicks..though honestly it would be great to marry an anon..can't imagine dating anyone comatose..and yes priorities have definitely shifted but it's worth it
>>2250144
don't worry..apparently i can't leave even if i try! lol wwg1wga fam
d79e48 No.2250182
>>2250124
Maybe. He still fucked a baby doll. Need to rectify still. If he’s doing that to hurt the deep state somehow there ought to be some evidence to back that up. I’m open to it I’d prefer to like that show.
The story is plausible. The show has some red pill material.
708354 No.2250183
>>2250162
Six degrees of separation…
get this message to the “sleeping” sheeple and watch what happens!
Our government has allowed an organized fraudulent centralized banking cartel to print fiat currency at will, which they use as an economic whip to beat ALL working people mercilessly…
They never ended slavery, they just figured out a way to include everyone in their scheme.
Q team, I urge you to return us to a constitutionally mandated monatary policy before we are confronted with the inevitable collapse.
Of course… we can’t say we weren’t warned:
"If the American people ever allow private banks to control the issue of their currency, first by inflation, then by deflation, the banks and corporations that will grow up around them will deprive the people of all property until their children wake up homeless on the continent their Fathers conquered…. I believe that banking institutions are more dangerous to our liberties than standing armies…. The issuing power should be taken from the banks and restored to the people, to whom it properly belongs."
-Jefferson
https://www.zerohedge.com/news/2018-04-02/there-no-escaping-history-fiat-currency-eventually-fails
fcfa75 No.2250184
>>2250166
IP hop some more, (((nigga))).
"normies" are WIDE AWAKE and pissed off now, you fucking idiot shill.
Clearly living in the #1 organ/human trafficking destination of the middle east while playing "chosenite" fucked with your perception, kikey.
We know your games.
There was nothing pleasing about "saving israel for last".
We remember JFK. You failed.
9f2d2e No.2250185
Another one bites the dust.
WW
https://www.stuff.co.nz/national/crime/105697372/Canterbury-sportsman-Harley-James-jailed-on-child-pornography-charges
e54c24 No.2250186
>>2250184
You are a disgrace to potus and to jfk.
Divide they try fail they will
1a7199 No.2250187
>>2250172
Florida if you can believe it. I say "Thank God for President Trump "out loud and everyone scurrys away and hangs there heads scared to agree or brainwashed. This is for sure a mental challenge as well as all the rest. This memewar is nothing to laugh at. Mentally I am cracking. Not blaming anyone or whining. I have been waiting for justice since 91101 and I can wait as long as needed. My hairline just gets higher and more wrinkles . For the future of the country and world's children its worth losing my life and every worldly possession to see Q win and Presidnt Trump win.
fcfa75 No.2250188
>>2250174
>don't care what we do, we are never guilty
>POTUS is ours
>"division fag"
>twist Q drops IMMEDIATELY to attack other anons, without fail
This. THIS is why you are being saved for last.
021485 No.2250189
>>2250184
That anon did not IP hop. They actually have a brain, unlike you fucking CIA Paid Nazi piles of shit
55c4f1 No.2250191
>>2250148
There are 100 pros that are beating you there.
Latest sample:
fcfa75 No.2250195
>>2250186
>>2250189
Y'all both giving a good show, you stupid fucking (((shills))).
>we speak for POTUS
>all of my c_a paid shills
For Christ's sake, these fuckers are not getting that no one cares what (((they))) have to say anymore.
>did not IP hop and DEFINITELY not using multiple devices, goy
Pic related.
CARRY ON, LADS. FUCK these (((shills))) and msm 4am points today
9293f2 No.2250196
why did george lucas give up directing starwars if he was hanging out for the tech to catch up to do it justice, ( coincidently it's also when it seemed to change direction drastically)
fa085a No.2250198
>>2250182
You should rewatch the show. You will find lots more than a little redpill material.
They do a currency reset. They do a kill everyone show who resist the President(showing Saudi and other foreigners). They mock everything.
See who supports this attack on Dan. And remember who they are. They will belong to (((them))).
They have no rainy days left. No reason to maintain their cover. The Jew is calling all their agents to the battle. Watch who you thought was on ourside seemingly go sideways and attack Trump. Watch who attacks Dan now. And you will learn how the game is played.
ff3feb No.2250199
Q and anons:
Throwing this out there.
I get a strong sense of, “Here we go.”
I see a lot of people in a huge meeting room.
I see everyone doing shoulder shrugs, as if to say, “We’re ready, is there anything else left to prep?
The meeting wraps up and as everyone rises and mills about the room, I see everyone looking around at each other as the answer comes back without words, “Yes, we’re ready.”
Some slight concern of “over” preparation, with some thinking, “Are we too cautious?”
I see everyone knows, “It’s time.”
No more talking.
No more planning.
Knowing the time has finally come, I see EVERYONE holding their excitement back.
Everyone is more than ready, almost too ready.
I see them extremely resolute, with a spiritual and Godly dose of self-righteous indignation.
I see them with an easy calm and a confidence in their given roles.
I know that they all know, they are on a very, very special team.
A once in a lifetime gathering of people all pulled together to do something special.
The feeling that each of them has of being a part of this team, is very powerful.
Everyone knows what’s at stake.
If God is for us, who can be against us?
Romans 8:31-39
31 After saying this, what can we add? If God is for us, who can be against us?
32 Since he did not spare his own Son, but gave him up for the sake of all of us, then can we not expect that with him he will freely give us all his gifts?
33 Who can bring any accusation against those that God has chosen? When God grants saving justice
34 who can condemn? Are we not sure that it is Christ Jesus, who died – yes and more, who was raised from the dead and is at God's right hand – and who is adding his plea for us?
35 Can anything cut us off from the love of Christ – can hardships or distress, or persecution, or lack of food and clothing, or threats or violence;
36 as scripture says: For your sake we are being massacred all day long, treated as sheep to be slaughtered?
37 No; we come through all these things triumphantly victorious, by the power of him who loved us.
38 For I am certain of this: neither death nor life, nor angels, nor principalities, nothing already in existence and nothing still to come, nor any power,
39 nor the heights nor the depths, nor any created thing whatever, will be able to come between us and the love of God, known to us in Christ Jesus our Lord.
This they know and know with all their hearts.
Nobody wants to let anyone down.
The sense of pride for this mission is overwhelming.
It’s the glue that binds.
They feel lucky to be a part.
They all know what’s coming next.
There is nothing else left to do.
They knew this very moment would come.
That time has now arrived.
Get ready anons, we will all be called upon.
The calm before the storm.
(Will report in next breads, it's important.)
021485 No.2250200
>>2250188
Saving Israel for last.
Actually.
The Rebuilding of the Temple of Solomon.
The very reason POTUS moved the embassy to Jerusalem.
But keep on hating God's word. You will enjoy eternity in hell.
3ff115 No.2250201
>>2250200
Go away kike enabler
e54c24 No.2250202
>>2250195
I know you want that soros paycheck but you are failing miserably. Might be back to the job boards for you really soon. Fuck off division shill.
d79e48 No.2250203
>>2250168
They can’t even get basic shit right.
021485 No.2250204
77e319 No.2250205
The jew pedos are being exposed as we speak, and all the jew enablers can tell us is how "Chosen" the jews are.
Jesus didn't think so.
The only "god" that would support the jews is the devil.
I think Jesus said so in the book of John.
e54c24 No.2250206
>>2250200
Saving israel for last probably means the deal of the century, the dismantling of israeli deep state and normalization in the middle east
7d0147 No.2250207
>>2250187
Just gotta take it one day at a time, I suppose. "Can I make it through this one day?" And what is happening in this moment? Plan, do the work, etc. But live for THIS moment.
55c4f1 No.2250208
>>2250188
Soros = Israel
I'm afraid you are gonna be real disappointed Adolf
021485 No.2250209
Therefore this is what the LORD, the God of Israel, says to the shepherds who tend my people: "Because you have scattered my flock and driven them away and have not bestowed care on them, I will bestow punishment on you for the evil you have done," declares the LORD.
Jeremiah 23:2
1556b1 No.2250211
>>2250149
>>2250125
sorry to hear about your cousin.
The waiting is like Christmas, you know it's coming, and can't wait to find out what the presents are, kek
Q said the attacks( from MSM ) would get worse.
ENJOY THE SHOW
This is the greatest events in history, which i could never miss.
GOD BLESS ALL OF YOU ANONS, STAY STRONG, DO NOT LOSE HEART.
JUSTICE IS COMING.
CHRISTMAS WILL BE HERE BEFORE YOU KNOW IT.
I WANT MY GITMO PERP WALK VIDEOS, KEK
I also want to be director of entertainment at GITMO.
THAT WOULD BE TOP KEK
I would play messages from the people, telling them what they really think of them, among other things( like repeating annoying music/videos)
fcfa75 No.2250212
>>2250202
>>2250200
>tfw these retards can't even change scripts because they are low energy at this point
Pics related.
Bark some more, (((shills))).
We and Q team KNOW you are trying to fuck with POTUS daily and try to bring down morale across the board.
THIS ENDS NOW, fucking (((scum))).
41963e No.2250213
>>2250026
>>2250055
You fucking newfags and your demands..
>1. why the newer breads are gone
Did you check the archive? https://8ch.net/qresearch/archive/index.html
>2. why the formatting of breads suddenly changed to not even show the archived Q-breads
There are many archives: one on 8ch (which might or might not be complete).
Dropboxes/megauploads etc online
fcf11c No.2250214
>>2250198
Entire cast and crew of Guardians came to the defense of James Gunn recently. Most vocally, Dave Bautista.
You know who didn't support Gunn amidst this controversy? Chris Pratt.
e54c24 No.2250215
>>2250208
Soros is hated by most israelis (those who are not progressive leftist). At least get your facts right, it is all open source.
879980 No.2250216
Not going to bring it up again as I don't want to spam but you anons really should look at that post and especially so if your city/area has recently been dealing with water issues. Anons on 8chan may have stumbled on to something pretty fucking immense… like next level monumental if more areas confirm as true.
046d29 No.2250217
>>2250199
>>2250183
>>2250168
I love this show.
Raise the curtains!
fa085a No.2250218
>>2250186
Wrong. Potus job is to keep us united, Q's job is to keep us united. OUR job is to tell the truth.
Truth is America has been propagandized by the total Jewish domination of any mass media for 150 years. A part of waking up is realizing this fact. Our job is to break the people who brave this site to learn all the truth and to harden their skins against the attacks of "nazi, muh holocaust,"
This site is not for the normies. This site is for the leaders. For the taste makers. For the intellectual vangard of a new Aeon. That is our job.
Your job is to shill for the Jews till the shekels run out. Listen for the knock.
9564c5 No.2250219
>>2250196
maybe he realized the tech had caught up and surpassed his imagination but would never be released to the public?
77e319 No.2250220
Look how utterly insane the kikes really are.
They think that the stupid goy will believe that everything that the fucking kikes so is being done by "Nazi's."
My God. These people are insane and need to be locked away.
1556b1 No.2250221
>>2250211
and videos of TRUMP WINNING, KEK
e54c24 No.2250222
>>2250218
Fuck off shill. Our job is to help normies walk through the storm and to counter the media spin attempts. Q stated it clearly.
Fuck off division shill
021485 No.2250223
>>2250212
You stand AGAINST Q and POTUS.
Sorry. but You have a slot in the gallows next to Hillary.
5be10e No.2250224
>>2250161
It was an obvious troll
6ccc04 No.2250225
>>2249671
You know, I've never watched it. Firing up Netflix now. Back in a few weeks (assuming it doesn't get taken off, but hey it's Netflix)
KEK+, in just the first minute. Wow. Yeah ok, back in a few weeks.
9564c5 No.2250226
>>2250199
what are you reporting in the next bread? and what are you describing? you a remote viewer? not trying to be an ass, just very intrigued..
1a7199 No.2250227
>>2250207
I will keep keep baking , praying and making memes/blasting them out. Saving offline and getting ready . Doing what Q says. Anon's are keeping my spirits up and I love to laugh at the memes . It's dealing with my family that is most challenging. Child like minds from TV and MSM brainwashing. I am used to being alone. Q will win Trump will keep winning and life will get better that is my AA. I read ACIM alot too that helps.
77e319 No.2250228
←- This comes out of the jew "holy" book.
It is fucking disgusting.
What normal person thinks fucking kids is ok?
Normal people do not.
The jews need to be kept as far away from normal people as possible.
b39e8e No.2250229
>>2250211
TQ
Anons have to keep focused on the destination
NOT the potholes along the way
d79e48 No.2250230
>>2250198
I’m seeing it happen, fuckin Marco was exhibit A. All of the fake personas will start falling away now.
I hear you anon. I only watched a few episodes, there’s plenty ignorance on this side. If he’s based he’s based and will be hero anon. I hope so we need allies in culture!
97fd77 No.2250231
a45d00 No.2250232
This place is a train wreck this morning.
I'm going to bed.
09138b No.2250233
>>2250195
> no one cares what (((they))) have to say anymore.
you're right about that. Especially
021485
But at this point, wnyone that continues to engage in this in-fighting and divisionfagging is gonna get filtered.
41963e No.2250234
>>2250080
This is very interesting..
Water is going to be the crucial conversation in human survival for the coming decades.
I must also add that The Netherlands is dealing with a very heavy dry streak (worse in about 40 years).
Didn't Liddle Lynn de Rothschild treathened with droughts?
fcfa75 No.2250235
>>2250222
>>2250223
What the world is going to do to these fucking idiots…
The jewish and middle east uppity criminal mind set runs DEEP.
We get rid of deep state, cabal, networks, and these fuckers will STILL be mired in this criminal mindset.
Which is WHY (((they))) will end, one way or another.
No more samson option. No more nukes in the middle east.
Only two additional rogue nuclear states remaining (israel and pak).
CHANGE YOUR SCRIPT, you fucking inbred (((retard shills)))
9992d4 No.2250236
The destination is glorious. Whatever it takes to get there, is worth it.
7d0147 No.2250237
>>2250232
Might as well rest. I'm sure the new day will be dense with news. Truly feels like we are on the verge now that the testimonies are coming in. Good night!
e54c24 No.2250238
>>2250228
The jewish holy book that is a 2000 year old oral tradition and bible interpretation. It doesn t enable anything you idiot. It has some stuff that will look barbaric to us just like some aections of the bible and like the quran. its an ancient text that the average jew cant even cite one sentence from it. Some very religious sheep do follow it literaly but they are sheep.
Fuck off division shill
021485 No.2250239
"In his days Judah will be saved and Israel will live in safety. This is the name by which he will be called: The LORD Our Righteous Savior."
Jeremiah 23:6
Thus saith the Lord.
You Shills can just go hang yourselves now.
7982b5 No.2250240
>>2250161
https://www.neonrevolt.com/2018/07/22/hollywoodrenegades-how-hollywood-insiders-are-taking-down-thecabal-from-the-inside-out-hollyweird-greatawakening/
e54c24 No.2250241
>>2250235
You sure love those soros shekels.
divide you try fail you will
fcfa75 No.2250242
>>2250233
Damn anon, I will say some newfags could hear it, and also (((they))) tend to extend their reach if nothing is done.
One slap down, will last for a day.
Also, no-"infighting" and "divisionfagging" where hostiles and shills are concerned…careful they try to spread that kind of lie everywhere while deflecting.
pilpul 101. also tries to work your fatigue.
We see it.
55c4f1 No.2250243
>>2250206
Agree
All the Skinheads are going to be real disappointed
Cleansing Crew Lask List
Saudi Arabia - done
NKorea - done
Russia - Certificate renewed
China - 1 st notification sent
Iran - In process
FBI - In process
CIA - In process
DoJ - in process
Congress - pending (Nov)
Isreal - pending
EU - pending
Rome - tbd
US - in process (pending trials)
af342e No.2250244
>>2249973
Comey is our guy. If he would have brought charges before the election, then the witch walks. He knew that.
879980 No.2250245
>>2250234
It's extremely suspicious, I agree and I now believe there stands a very good chance this is the "watch the water" meaning. It makes sense to me given how many different areas are saying the same thing.
ff3feb No.2250248
>>2250226
Not a remote viewer anon.
Not being short with you, but I would rather leave this question alone for now?
Please?
As for a report in next bread, I should have been more clear.
I'll just copy and paste this in the next couple of breads for others to see.
Do me a favor please? Can you copy and file this?
Thanks.
Please pray for President Trump for his health and safety, that's big.
As well as Q and all the others involved in this battle of good over evil.
God bless us all.
WWG1WGA
fcfa75 No.2250249
>>2250246
>(((YOU ALL NAZZEZZZ)))
Damn, that sounds familiar. Same enemy JFK fought.
77e319 No.2250250
>>2250238
Go ahead and defend the pedophilia, the lying and stealing from the goy all you want.
I will keep exposing it to the brainwashed goy that have no idea that this is what kikes are all about.
021485 No.2250252
>>2250235
There are bad actors in Mossad. So you condemn all of Judah.
There are bad actors in the CIA, FBI, NSA. Do you condemn all Americans?
The Talmudic Jews are a tiny satin worshiping cult, so you condemn all of Judah.
The Mormons are a tiny satin worshiping cult. do you condemn all Americans?
09138b No.2250253
>>2250242
you know very well what happens when jews and kikes are brought up. It is an endless slide. No one is going to change a newfags mind about their stance on the subject. Continuing to fight about it serves no purpose but to shit up the bread. You know this. Be the strong one and don't engage.
41963e No.2250254
>>2250245
Your posts just activated my almonds:
We need Air -> that is being poisoned
We need Water -> They want to control that, as the thread shows. They are poisoning the sea as well (Fukushima? Oil spills?)
We need Food -> GMO Monsanto/Bayer/IG Farben are balls deep in that. Next to that: there are only a few, huge companies that dictate this process worldwide.
And to top it all off, the fire of critical thought is being subdued by this manufactered hoax called global warming.
Fuck these people. Global Tribunals when?
77e319 No.2250255
>>2250251
The kikes think they can hide their crimes because they control media, education, etc.
Too bad "Al Gore invented the Internet."
Now the Goyim know, and we are pissed.
e54c24 No.2250256
>>2250250
>>2250251
As always no real argument against what i wrote. Just blah blah blah goy blah blah blah kike.
divide you try fail you will:
>>2250247
2e9175 No.2250257
Basket of deNotables
#2836
>>2249797 Got us another one "screaming loudest," NY Rep. Jerrold Nadler
>>2249782 Prominent S Korea politician found dead in possible suicide
>>2249754, >>2249762, >>2249850, (>>2249386 lb) AP Cov'g of Iran Tweet
>>2249741, >>2249818 Mission Impossible 7/27 Release, 'dasting Soundtrack
>>2250031
>>2250082
>>2250107
Thanks BO, glad you're here.
Lemme know if I can help.
>>2249959
TY anon
ab5b87 No.2250258
meme for twatters…
https://thegoldwater.com/news/32028-Peter-Strzok-s-SEC-Director-Wife-Blocked-FBI-Investigation-Into-Clintons
55c4f1 No.2250259
>>2250244
He didn't do it for Trump - he gave her a free pass
He went total Dark Side - irredeemable
1a7199 No.2250260
>>2250254
They want to MUTATE everything God created perfect and make it filthy . They will kill down to the last man on Earth. No one is safe from the ego's wrath and self destructive ways.
fcfa75 No.2250261
>>2250253
Yeah why not. Not like we actually get anon or autist replies when JIDF gets shut down. Pretty much zero sympathy for kikes in truth seeking parts.
I suppose today's msm efforts will be repeating the faggotry they do here today:
>"trump is causing division"
>"they are all nazis"
At least we got to know something ;)
046d29 No.2250262
>>2250209
Why don't the Jews like to say the name of their g-d? Are they ashamed of something?
bf7538 No.2250263
Steven Greer had his Disclosure Project shill meat hooks all up in this. Wonder what he will say now
Controversy over Atacama 'alien' deepens: Follow-up to study on 6-inch Chilean mummy uncovers faulty methods and ethical concerns, finding it was a NORMAL human fetus and 'reflects a sad loss for a mother'
Study published earlier this year concluded tiny mummy ‘Ata’ was a human girl
It claimed she suffered genetic abnormalities, including ‘accelerated bone age’
New research has called into question both the science and ethics of the study
Researchers say analysis was unjustified, and skeleton is a typical 15-week fetus
They also say it was likely a miscarriage, possibly from a recent incident in Chile
https://www.dailymail.co.uk/sciencetech/article-5975679/Atacama-alien-controversy-deepens-new-study-points-ethical-concerns-faulty-science.html?ito=social-twitter_mailonline
1a7199 No.2250264
>>2250256
I was posting the meme not as an insult to you .
ece830 No.2250265
I don't know if mentioned, but I was posting the DoD's tweet about staying calm and taking a breath and watching the ocean video (water)…when I saw the prior tweet about the AF airman having his body mass measured in some type of ALIEN-movie type of pod that looks like it just came straight of the spaceship Nostromo. Then I remembered that the DOD said:
I think I saw this on the #Jetsons once …
Then I remembered Trump's tweet out to Rouhani that sounds like we are preparing to go to war with Iran.
Then it clicked!
DoD was already preparing us to start thinking about SPACE FORCE!
77e319 No.2250266
>>2250256
There is no need to argue. The information is available to anyone who has the courage to read it.
You bullshit tactics won't work.
We are on to you.
879980 No.2250267
>>2250254
I seriously think you and I may be the only people legitimately looking into Q research right now on this thread given the gravity of this and the fact it's just us seriously looking into it even with the "watch the water" statement awhile back we never figured out.
But you're right, you're absolutely right in what you wrote. Air, food and water and fruits and vegetables have seen a huge uptick in being recalled due to chemicals and feces the past few months in the US.
391e8c No.2250268
>>2250194
IS SUMNER REDSTONE THE KEYSTONE?
5be10e No.2250269
>>2250256
Stop being butthurt and read what people post faggot.
>These guys agree with me ! Very divisive…
021485 No.2250270
>>2250262
It is a sign of respect. You ignorant pile of dog feces.
55c4f1 No.2250271
>>2250255
You Skinheads are always pissed
No one else agrees with you but the Palestinians. MB and Iran Mullahs.
Large shipment of Butthurt headed your way
fa085a No.2250272
>>2250222
Your not a very good anon. You seem to think Q tells the truth in everything. You forget one of the first post Q made. Disinformation is necessary.
Israel is last. All disinformation is to avoid Jew panic and to confuse normies of the true endgame. MI worked this out. How to free yourself from a parasite that has magickally fooled most of your own people into thinking they are victims and innocent?
How indeed?
How my anon?
What has happened the last nine months?
This is how. This. Q. Me…..you…..everything. Is how.
e54c24 No.2250273
>>2250260
I know. I used it on them. Thanks for the awesome meme
77e319 No.2250275
>>2250271
I went from being a Nazi to a Skinhead. Great.
You are still a kike.
We goyim are on to you.
Even Tay the AI figured it out.
55c4f1 No.2250276
>>2250267
You must have been sleeping that day.
Solved - water scenery in NK leadership photos
Raging rapids & rivers before
Calm serene waters after
9564c5 No.2250277
goodnight/morning anons
ty baker and BO <3
021485 No.2250278
>>2250274
Problem with IP hopping, is you miss shit.
>>2250252
bd0338 No.2250279
I think the gestapi
All had a crack smoking gi Joe fetish they never paid taxes on
879980 No.2250280
>>2250276
Did Q confirm that as accurate or is that the current working theory?
7982b5 No.2250281
I actually disagree with the top anon post here. Renegade and others should ONLY be going to 8ch, and not 4chan, since 4chan is compromised, and 8ch is most likely under control of the US Gov’t at this point.
77e319 No.2250282
Telling the truth about the jew causes division.
I think it is the opposite.
It brings the goy together.
Jews really hate that.
Too bad, kikes.
021485 No.2250285
>>2250271
Kek,
When you replace Jew with White. It becomes crystal clear who [these people] actually are.
e54c24 No.2250287
>>2250272
I know. I used the meme on them. Thanks for the awesome meme.
021485 No.2250288
BO, you sent your IP hopping attack dogs after me, but you did not answer my question.
5be10e No.2250289
>>2250281
Still most people visit half chan. If you want your message to reach most people as fast as possible you would post it there.
We got it here anyways.
And if renegade's story is to be believed he doesn't care about his life anymore, so he doesn't care about the danger.
77e319 No.2250290
(((AFLB's))) bitch is back.
Yay!
e54c24 No.2250291
>>2250264
I know, I used the meme on them. Thanks for the awesome meme
bd0338 No.2250292
And here is meme of my murderer going unprosecuted during mah usrico18
How false
How muh Satan
Kys
2e9175 No.2250293
>>2250277
TY anon.
>>2250282
Classic narcissist/terrorist manipulation:
Threaten, gaslight, isolate.
No more.
9992d4 No.2250295
>>2250286
Blah blah and Fuck you for the gore pics….Filtered
55c4f1 No.2250297
>>2250272
Delusional
Are you not aware the Trump' daughter, son-in- law and grandchildren are Jewish?
You might be happier with Hamas & Hezbollah
The are always looking for more suicide bombers.
No need a letter of reference?
fcfa75 No.2250298
>>2250264
Amazing how loud (((they))) scream…
Honestly how obvious can they get?
>>2250278
english, faggot mossad shills. Take 55c4f1, e54c24, bce742 (copying sandnigger turk half chan bullshit) with you and tell your boss you failed.
>>2250285
same old tired (((bullshit))) script
fa085a No.2250299
>>2250252
Do they use only Americans to run the worlds banks? No Jews.
Do they use Eskimos to run all the worlds media? No Jews.
Do they use Japanese to run all the worlds films? NO again that is a role set aside for Jews.
See what is happening here?
It is debatable who is at the top of the pyramid of the NWO. But what is not debatable is the Jews are the number one weapon in bringing in this horror show. Only Jews are trusted this much to genocide and rob the nations of the earth this much.
77e319 No.2250300
>>2250293
Classic Kike deflection.
Jesus, you kikes are not as bright as you think you are.
bd0338 No.2250301
Carnivorous crack head tax dodger bone spurs
German engineered
41963e No.2250303
>>2250267
>>2250276
You are partially right: in the scenario of NK, that one proved to be most fitting.
However, we are dealing with MI here: if they ask if you want a croissant with your cafe latté, they might be asking you if you believe if the Crescent Moon will light the waters of the the center Milky Way or something
The "Watch The Water" has many, multiple layers of meanings. I honestly believe that dominating the water supply is one of the big issues associated with it.
fcfa75 No.2250304
>>2249757
Just FYI, we got the usual charade of (((shills))) lined up for your morning bakes ;)
>>2250298
tactics and litany of shill lines too, just to notify newfags.
Godspeed, clam baker.
021485 No.2250305
>>2250299
Who put the jews in charge of the banks? Catholics. Grow a fucking clue.
fa085a No.2250307
>>2250263
Dont know what that thing is…will say the Daily Mail is Jewish….so not taking their word for shit.
1556b1 No.2250308
NASTY ASS SHILLS THIS MORNING FFS
5be10e No.2250310
You know you are onto something when the obvious spam shill gives you a (you).
(pic unrelated)
bd0338 No.2250311
CRack head sexslave is a what ?
1a7199 No.2250312
>>2250308
It's the black supremacy larp this morning . For sure filthy tits ex bv.
5be10e No.2250313
>>2250310
(also wrong pic…´)
77e319 No.2250314
>>2250305
The Catholics did not start the Federal Reserve.
Grow a fucking clue yourself.
fcfa75 No.2250316
>>2250310
Funny thing is…I ain't exactly white….
These (((shills))) are FUCKING RETARDED LOL
inb4 nigga IQ for responding to shills this bread.
35d493 No.2250317
>>2250026
Don't rope me into this concern faggorty; It's a known issue that has been already noted in the dough.
021485 No.2250318
>>2250314
Who put the jews in charge of banking.
bd0338 No.2250319
Sacrificial superficial asshole demiurge ASSange(L) whom is totally homo for Elons glittery vampire salad tossing tribe with tredeau , and butt paste
77e319 No.2250321
>>2250318
You are taking one side of history, and making it into the whole picture.
You are being intellectually dishonest, but then, you kikes can't tell the truth no matter what.
Did Catholics start the Bank of England?
How about the FED RES?
Nice try.
bd0338 No.2250322
Elon gobbles black like mueller
fa085a No.2250323
>>2250267
If Jews cant own the world they want to destroy it and poison us all. They would try to nuke us but the Aliens are tired of their shit and turned all the nukes off. This is the great secret Iran threatened to tell the world. The fucking nukes dont work and we cant nuke each other. The Jew Samson option is off the table. The Jews are cornered……they have to make a deal. To become a multicultural country or Russia will just over run it.
Soon they will be bred out of existence by the Palestinans. Fucking Karma. Karma is a real bitch.
fd00d0 No.2250324
Examples of:
(1) Properly ARCHIVED Q-BREAD from 3/28/18
https://8ch.net/qresearch/res/821673.html#822219
(2) 404 Q-BREAD from 7/4/18
https://8ch.net/qresearch/res/2029070.html#2029255
Several Q-BREADS generating 404 errors (2), rather than properly archived (1).
Pic related, showing evolution of BREAD formatting, removing previous Q-BREAD lists.
>>2250257
55c4f1 No.2250328
>>2250294
I thought the all moved to from /pol/ to /skinheads/
We like top keep them in their own containment area.
Makes is easier for to merge with post there and to /nationofislam/
Did you get those quotes from the great warrior Shaka Zulu
I hear they are trying to make a comeback.
You any good at killing Boer farmers?
They always looking for recruits
a7b0c4 No.2250329
possible secondary sky event?
1556b1 No.2250330
>>2250325
Was about to post the same, POTUS IS AWAKE
TWEET THIRTY, KEK
775577 No.2250331
fcfa75 No.2250332
>>2250325
Maybe POTUS and fitton worked out a message for us?
Also, judging by the speed with which the niggastronk spams are occuring, it's likely a bot/script by these kikes. At least it used to be less automated but they lifted this copy pasta shit from half chan
1556b1 No.2250333
>>2250330
>>2250325
He's actually up , an hour earlier than normal.
fa085a No.2250335
>>2250274
Until the whole show is over....it is best to avoid believing anything a Cohen says.
35d493 No.2250336
>>2249943
I don't know, and I don't give a shit. It's nothing but concern faggotry at this point. We havethousands of backups.
bd0338 No.2250337
SUpport crack heads tax fraud for glittery famewhore salad tossing vampires in electric cars with autopilot and trannyshillin pedoraptor
18ecdd No.2250338
>>2250330
He seems fired up this morning. Never saw him wait until the last minute to point to faf. Normally posts it a couple days or at least the day before, the follows up right before the segment
0d6109 No.2250339
>>2250246
https://theralphretort.com/rick-morty-co-creator-dan-harmon-deletes-twitter-after-child-rape-comedy-bit-surfaces-7022018/
https://archive.is/6wcL1
>Gaining traction
be2565 No.2250340
I wonder what the original 4 am talking points for today were before the Iran tweet.
fd00d0 No.2250341
>>2250324
July 12
July 20
July 23
fcfa75 No.2250342
>>2250328
^ dumbest JIDF shit I've seen all month.
>kill boers
now (((they))) are just openly threatening for newfags.
>>2250338
I believe the man sleeps for only 3-4 hours a day. High energy.
2e9175 No.2250343
>>2250304
….aaaaaand cue black man best man pron
kek.
Guess it's time to load my Blink 1488 playlist and get this party started
>Godspeed
Thanks man, appreciated.
Couldn't do it w/o you guys.
Godspeed back atcha
>>2250308
So flak, such over target!
Why tho? What diggs tonight?
Not intel, PERSONNEL.
You. The autists.
Night-to-day
bd0338 No.2250344
When you steal one of those new fancy electric cars , it is called an "Edison"
021485 No.2250345
>>2250321
ROFL… Who is taking only one side of history.
Ohhh that's right you ridiculousness fucks that think that only the jews are responsible for everything that is wrong in society.
7ce54f No.2250346
>>2250325
>Fitton urging DJT to declassify.
bd0338 No.2250347
I Know
I'll just let the targets transmit
Then crush them
35d493 No.2250348
>>2250337
Somebody sold you some shitty crack, bruh..
1a7199 No.2250349
>>2250325
Good Morning Trump is your President !
fcfa75 No.2250350
>>2250343
>Why tho? What diggs tonight?
(((they))) are just trying to mess with the tone of the day early. shill 101.
Also, check
>>2250316
for jews retarded enough to tag me with niggastronk copypasta spam
PATRIOTS FIGHT
fa085a No.2250351
>>2250294
The smell of panic this gives off is powerful. We know how scared you are. You were kings of the world. No one was going to catch you. You had all the media and all the politicians.
And now all you have is race baiting and gore porn.
Expect the knock.
bd0338 No.2250352
>>2250349
Look a cia experiment gone wrong
77e319 No.2250353
>>2250345
For those that don't understand the "Catholics" made jews into bankers" lie. It goes like this.
The fucking jews have always been in banking.
The fucking kikes always charged interest also known as Usury,
The Catholics, being greedy cunts in their own right, made an exception, and allowed their money to be run by jew banking.
So the lie that Catholics made the "jews do it" is just a fucking lie.
Don't be taken in my the lies of the jew.
it is all they know how to do.
bd0338 No.2250355
>>2250348
I got murder charges on trump
916bc7 No.2250356
>>2250325
Fitton urging DECLAS
a7b0c4 No.2250357
Diverting for weather.
it that a storm coming indication?
fcf11c No.2250358
bd0338 No.2250360
>>2250354
And this is harrasing the plaintiff
bd0338 No.2250361
>>2250356
And it's fucking intentional
1a7199 No.2250363
>>2250352
You have no idea who I am but I know who [YOU] are .
bd0338 No.2250364
>>2250359
Tacky faggot white people
35d493 No.2250365
>>2250355
Are you sure that's even crack you're smoking?
5be10e No.2250367
Did you guys see that or is it just me?
I called out nigger-shills tactics.
He then wen't on to randomly target a few more posts, just to invalidate my point and now he's gone.
Kek
They are really retarded
021485 No.2250369
>>2250353
The Idol worshipers could not charge interest, so there was no reason for them to lend. Except out of the "Goodness of their hearts". and since they had no hearts there was actually no reason to lend.
Do all the mental SJW mental gymnastics you want, You are living in fantasy land.
18ecdd No.2250370
>>2250346
Hell yeah!! Should be an exciting day
708354 No.2250371
Just FYI
Q friendly, Sgt Report’s YouTube account has been terminated…
1a7199 No.2250372
>>2250366
Meber they said they have your passwords to your VPN. Q has it all . an't wait till [you] are gone. Last you for you E-Butt , I won't say your real name here. Time to go to sleep faggot. Give it a rest .
bd7714 No.2250373
Almost fill, every honest anon understands that antiseptic discussion at this point is premature. Israel is saved for last. As events unravel with regard to Iran we will see which direction POTUS and admin will go. If you trust the plan, you know they will do it right. Just need to be patient. Hours spent on discussing jew issue are a waist of time at this point, as we lack insight.
35d493 No.2250374
>>2250367
That's part of the script. There's probably 2 or 3 different variations of the original ones by now..
fcfa75 No.2250376
>>2250360
>>2250364
I also like how (((shills))) are now reduced to talking shit about white people on Q research board of all places.
Funny how this coordinates with known jidf/black hat shills on the bread, yeah?
PIC FUCKING RELATED.
D5 incoming, anons.
Clapper: Obama Was Behind The Whole Thing
https://www.zerohedge.com/news/2018-07-22/clapper-obama-was-behind-whole-thing
"Former Director of National Intelligence (DNI) James Clapper admitted in a CNN interview Saturday that former President Obama instigated the ongoing investigations into Donald Trump and those in his orbit.
Speaking with CNN's Anderson Cooper, Clapper let slip:
If it weren’t for President Obama we might not have done the intelligence community assessment that we did that set up a whole sequence of events which are still unfolding today including Special Counsel Mueller’s investigation. President Obama is responsible for that. It was he who tasked us to do that intelligence community assessment in the first place.
James Clapper admits to Anderson Cooper that Obama set off the sequence of events that led to the Mueller investigation by tasking the intelligence community assessment pic.twitter.com/v79PNuTxBe
— ᏢᏒᎥsᏟᎥᏞᏞᎪ’s ᏉᎥᎬᎳ ™️ (@PriscillasView) July 19, 2018
Recall in May, Senate Judiciary Committee Chairman Chuck Grassley (R-IA) fired off a letter to the Department of Justice demanding unredacted versions of text messages between FBI agent Peter Strzok and former bureau attorney Lisa Page, including one exchange which took place after Strzok had returned from London as part of the recently launched "Operation Crossfire Hurricane" referring to the White House "running" an unknown investigation."
55c4f1 No.2250377
>>2250327
You get an F for FAIL (plagiarism). Had to steal from the Turkman?
(Sadface)
(BTW - Your site malware isn't functioning any more) - FAIL)
The TÜRK man is the epitome of male dominance and masculinity …
https://veekyforums.com/…/the-trk-man-is-the-epitome-of-male-dominance-and.html
Aug 19, 2017 - 32 posts - 29 authors
His body is large. His domineering size makes his presence known without him even needing to point himself out.
KARA BOĞA | Know Your Meme
https://knowyourmeme.com/memes/kara-boga
His body is large. His domineering size makes his presence known without him even needing to point himself out. He is muscular, as a result of his high levels of
First /int/ post mentioning KARA BOĞA, From an Anonymous Turkish poster.
KARA BOĞA is originated from Turkish shitposters on 4chan's /pol/. Around June-July 2017, Turkish shitposters created several anti-white, pro-black or pro-muslim threads on /pol/. These threads received an extravagant amount of butthurt from the white and American users of /pol/. That these threads usually gets +400 posts unless the moderato(s) delete it. On these threads Turkish posters usually preach the Black supremacy and call muscular Black men as Black Bulls ( Bull = cuckold term for the person who fucks the cuckold's wife/gf). These events was eventually led to the birth of KARA BOĞA.
77e319 No.2250378
>>2250369
Translation: I got nothing.
Thanks for agreeing with most of my argument, though.
a7b0c4 No.2250381
>>2250325
2 mins before start must be a message from Tom?
1556b1 No.2250382
Donald J. Trump
Verified account
@realDonaldTrump
50s51 seconds ago
More
So we now find out that it was indeed the unverified and Fake Dirty Dossier, that was paid for by Crooked Hillary Clinton and the DNC, that was knowingly & falsely submitted to FISA and which was responsible for starting the totally conflicted and discredited Mueller Witch Hunt!
046d29 No.2250383
>>2250345
Not everything. Just 9/11.
e8e53f No.2250384
Regarding the threads falling off
It looks serious and extremely unusual.
- All Q posts in qanon.pub, qanon.map and qanon.news link back to our archived breads at the /qresearch/ 8ch archive at
https://8ch.net/qresearch/archive/index.html
- As you'll see there, threads from July 1 onwards have not yet been archived yet and we don't know how many are missing from the catalog.
- If they're missing, are they 'unarchivable' now to our central archive?
- Numbers: Generals #2463 - #2836 have yet to be archived = 373 general threads have yet to be archived and some are missing.
- Checking at qanon.pub and Q's last post links to the (what should be) archived page, which is not found. Pics related. Link: https://8ch.net/qresearch/res/2029070.html#2029255
- I asked BO about the archives yesterday and he said he thought they were archived at the end of each month.
- This would normally be fine, as threads stay in the catalog at least a month, however this time with threads going missing it seems we could be in a 'pickle'.
- I'm unsure if the archives are done automatically or by hand, either way, I believe this should be looked into, as it seems we've already lost breads.
- Archives should possibly be done by hand at the moment, on all breads still in the catalog, until it's found out what's happened. That way we can be safe rather than sorry.
9a5d84 No.2250385
ff9f5f No.2250386
https://twitter.com/realDonaldTrump/status/1021341698734030848
517d18 No.2250387
>>2249615
It was Pocahontas's opponent, Dr. Shiva that was punched in the face by a Warren supporter.
021485 No.2250388
>>2250378
Translation = You are nothing but a hate filled troll. Who will spend the next few eons burning in hell.
e8e53f No.2250389
>>2250384
Missing screencaps
55c4f1 No.2250390
>>2250374
I think I scared them off with the Burly Q gladiator
be2565 No.2250391
>>2250080
Very interesting find, Anon. Strongly recommend that others check that thread out.
35d493 No.2250393
It got quiet in here now that the shift ended.
Pay attention to who is suddenly not prosecuting their slides ;)
35d493 No.2250394
fe9082 No.2250395
Baker
This is TZ… I found more faults in the bread…
From >>2249666
Integrity–for in Truth lies Victory. Replace strange stuff in middle with dash.
HIGHLIGHTED Q POST
Q !UW.yye1fxo ID: 27d57d No.594016 ðŸ“
Mar 8 2018 19:55:52 (EST)
Anonymous ID: 576924 No.593959 ðŸ“
Mar 8 2018 19:53:28 (EST)
nov14.png ⬇
Note the strange characters at the end of the lines
>>2249677
Between 40 and 70 should be a dash
CURRENT EXPOSURE #QAnon: 40 – 70 MILLION EXPOSURES/DAY!
I have found strange stuff like this before. Some baker has something funky with his computer that corrupts dashes and other characters (as shown above)
77e319 No.2250396
>>2250388
That's all you got?
If there are no jews in Hell, it will be heaven to me.
35d493 No.2250397
>>2250395
Were they tabletfagging I wonder?
1556b1 No.2250398
>>2250392
just noticed a 17 min marker between the 2 tweets
021485 No.2250399
>>2250383
that was all of them. the Bushes, the Clintons, the Bin Laden, and the Roths. If you think it was just the Jews, you are one of the 4-6%
a7b0c4 No.2250400
fe9082 No.2250401
>>2250397
Dunno. I've corrected stuff like this three previous times. I had to go back to 2821 to get uncorrupted EST archives last bread. I missed the things above until just now.
bd7714 No.2250402
2e9175 No.2250404
>>2250395
Thanks TZ. On it.
5771be No.2250405
We are aware of the issue with an accelerated pattern of some breads being 404'ed from /qresearch/.
a whole catalog full of breads and all the ones with the Q posts have fallen off…
I told BO this was happening right after CM fixed the catalog… but nobody listens.
af56b5 No.2250407
>>2250386
Before Fitton came on F&F. Todd Piro [host] made comments about RR
He was asking if RR just rubber stamped the FISA warrants and renewed them after they expired
He was making comments that we [American public] needed to know if he was following orders from above or more like a worker bee just signing whatever came across his desk
fcfa75 No.2250408
>>2250406
>>2250400
Q team notifying us as always.
Q team is NEVER far away.
5be10e No.2250409
>>2250399
funny i got a lot of backlash a while back for saying something similar.
Don't focus on the label they give themselves. Labels are hiding spots.
Focus on what they do/have done.
021485 No.2250410
>>2250402
the Bin Ladens are/were part of the house of Saud.
879980 No.2250411
YouTube embed. Click thumbnail to play.
Hispanic name, "severe mental illness", kill cop, kills old lady… not a peep from the MSM. By the way, nice Hispanic name while clearly being a Muslim
2e9175 No.2250413
>>2250300
Dude I was agreeing with you.
Describing (((them))) not you, kek
fcfa75 No.2250416
>>2250411
Good chance muzzies are swapping names when coming over from mexico illegally.
Border is more important than you know. We know the muzzies are trying to get to mexicans.
bd7714 No.2250417
>>2250410
True so but Saudi involvement was not limited to Bin Laden family. Thats what i meant
77e319 No.2250418
>>2250413
KEK.
Sorry, bud.
Been fighting with them all day.
Sorry for the cross-fire.
021485 No.2250419
>>2250409
One tends to get a lot of backlash for suggesting anything was not "The Jews"
879980 No.2250420
>>2250416
Yep, exactly my point, good call anon.
a7b0c4 No.2250422
YouTube embed. Click thumbnail to play.
ok
found this re tom fitton
dont know what is going on but behind the presenter someone is watching the water?
070a7d No.2250424
>>2250376
>www.zerohedge.com/news/2018-07-22/clapper-obama-was-behind-whole-thing
35d493 No.2250425
>>2250409
>Labels are hiding spots.
>Focus on what they do/have done.
FUCKING THIS
Thank you! :)
1a7199 No.2250427
>>2250386
I like this guy .
046d29 No.2250430
>>2250414
Let's wind the clock and see if there's anything interesting at +/- 17 from [:48] / 07/23
55c4f1 No.2250432
>>2250421
Public service post to bump some trash
0e4f36 No.2250433
Large Cap CEO’s dropping swatted Flies.
https://www.cnbc.com/2018/07/22/how-fiat-chrysler-told-employees-sergio-marchionne-was-being-replaced.html
Coincidence?
879980 No.2250434
>>2250427
The big question is will something actually happen and people held responsible.
fcfa75 No.2250435
>>2250424
Now they are throwing fake nigga hussein under the bus.
This is getting serious enough to make this happen.
Possible bait by black hats to make white hats move early?
>>2250426
BO or BV, can we stop making these (((shills))) remind me MUH big black dick fucks jewish women and they like it?
shadilay, anons
28ba4d No.2250436
>https://www.youtube.com/watch?v=0kHP1px8uS4
ARE THE DEEP STATE CABAL TRAITORS PLANNING TO ASSASSINATE PRESIDENT DONALD J. TRUMP TODAY 7/23?
USSS / NSA ECHELON SEE THIS
fd00d0 No.2250437
HookTube embed. Click on thumbnail to play.
flashback monday
japanese commercial for potus
e54c24 No.2250438
Done with the nazi spamming and on to the black man shilling
Lol
a7b0c4 No.2250441
>>2250422
4:10
presenter
Judicial watch brings lights
28ba4d No.2250443
>>2250439
>His behaviour strikes fear into the more timid, cowardly races of man(ʷʰ*ᵀᵉ dogs)
Kek that's why white men had to free nigger slaves from kike slaveholders.
74e5d3 No.2250444
>>2250125
What are the chances this post will end up in a media article
1556b1 No.2250446
Da Bongino is up early, hes on fox and friends
fd00d0 No.2250447
>>2250444
right. like the dirty cop who plants drugs in your otherwise-contraband-devoid vehicle.
35d493 No.2250448
>>2250436
Whatever trigger you included in this post… triggered the nigger ;p
kek
5be10e No.2250449
>>2250419
Yeah. I was a fucking rabbi for suggesting that not only Jews could be part of the evil.
Kek.
>>2250425
You are very welcome
517d18 No.2250452
>>2250168
The left is still trying to disprove pizzagate by making false statements. They are trying to taint Q by associating our movement with pizzagate. Some things never change.
fcfa75 No.2250454
>>2250449
>imagine being this stupid and responding to a known jidf
lurk moar nigga.
>>2250451
Perhaps rouhani is out of the loop, or being set up?
This will go very badly for rouhani one way or another.
We know white hats and POTUS have upper hand on iran.
2e9175 No.2250455
9a5d84 No.2250457
>>2250125
sauce or it never happened.
be2565 No.2250458
>>2250080
>>2250234
>>2250391
Screencap about Yolayo Dill fucking with our water supply. Definitely worth the dig.
2e9175 No.2250459
#2836
>>2250386 @DJT comes out swinging: "So now we know" Dirty Dossier Fake
>>2250185 Another one bites the dust: Sportsman Harley James jailed for CP
>>2249988, >>2250063, >>2250104 Barrick Gold/Clinton/Shoshone/Burns Strider
>>2249797 Got us another one "screaming loudest," NY Rep. Jerrold Nadler
>>2249782 Prominent S Korea politician found dead in possible suicide
>>2249754, >>2249762, >>2249850, ( >>2249386 lb) AP Cov'g of Iran Tweet
>>2249741, >>2249818 Mission Impossible 7/27 Release, 'dasting Soundtrack
28ba4d No.2250460
>>2250448
Whatever it was, odds are it's a kike. Niggers can't spell words with more than 2 syllables.
fcfa75 No.2250463
>>2250458
We are aware of the cabal tech including their study of tesla which should have given them the starting point to the science of "telegeodynamics"
While average people are made to wish on a fucking bone to dig for wells and hit water, it's a sure bet cabal already has most of the world's underground water aquifer mapped out.
5be10e No.2250464
>>2250454
>Imagine being this stupid and responding to a poster responding to a shill…
35d493 No.2250470
Full court press. [They] are giving us all they have right now anons.
It doesn't matter, [shills]. Even if this place is overrun, we've broken 10% visibility in the world.
It's too late to stop it.
e54c24 No.2250471
>>2250266
You are on me with 20+ division shill spamming.
Divide you try fail you will
fa085a No.2250472
>>2250419
Have you noticed? No topic brings this much resistance. None. And they are only 1-2% of the population yet about 75% of the shills are Jew apologist. The numbers dont make sense if your a normie and can do math. Just look at the zeal of the Zionist. They know the danger to them. They know they have little real power that is not media based. If they lose the propaganda war they know what is coming next.
They played the game of thrones as a win all or a lose all proposition. They are in the process of losing all.
They are going through the five stages of grief.
The five stages, denial, anger, bargaining, depression and acceptance are a part of the framework that makes up their learning to live with the world they lost.
They are still in the denial and anger part. Soon the bargaining and depression will set in.
The Kvetching will start up. Nothing is louder than a Jewish wail over lost shekels.
Then acceptance. That is when they will run for their bunkers, cash out their assets, take for the hills.
But the world is smaller today and there is no where to hide. Bunkers flood and a vulnerable to shit being dropped on them.
2e9175 No.2250473
>>2250418
>Sorry for the cross-fire.
No worries. Appreciate the spirit.
>Been fighting with them all day.
Feel ya bro.
Keep up the good fight.
879980 No.2250475
>>2250458
I don't think people are seeing the magnitude here…
8057b5 No.2250476
Thank you anons and shills for helping more people daily wake up and wipe the sheep out of their eyes.
WWG1WGA
de5528 No.2250477
fa085a No.2250479
>>2250438
(((they))) are confused.
021485 No.2250480
>>2250449
[They] will get their eternal rewards. And it will be glorious.
2e9175 No.2250482
517d18 No.2250483
>>2250461
Is that all you have butt plug? Take your stupid gore porn back to the shit hole half chan or reddit from which you crawled. Climb back up in your mamma's asshole you were spawned from.
a7b0c4 No.2250485
>>2250422
OK
guys can you check this your end?
fox and friends today
5:5
timeline shows 5:14
1+4 =5
5:5
my sound cuts off
crazy shit in the background including strange visuals?
could be nothing
bd7714 No.2250490
How many attempts on POTUS and fam do we know about?
a7b0c4 No.2250491
all the fucked up images on the board
Are we being prepped for what is to come?
choice to know is ours?
long shot!
fcfa75 No.2250492
>>2250472
>They played the game of thrones as a win all or a lose all proposition. They are in the process of losing all.
Couldn't have put it better myself.
>>2250490
at least 5
>ivanka heli attempt
>jr. wife and kids with powder
>AK missile
>UK dead USSS agent
>POTUS during 2016 rally (rushing the stage by deranged lib from UK)
e54c24 No.2250493
>>2250472
divide you try fail you will
Paid soros division shill.
The jews blah blah blah the kikes blah blah blah
Keep generalizing and using group identity politics like your friend soroa and his herd of sheep.
19ef50 No.2250494
>>2250458
Interesting theory and evidence until it starts talking about redirecting underground aquifers.
You can put down a bunch of wells and drop the water table and dry up home owner's shallow wells, happens all the time.
When you start talking about redirecting underground aquifer's without a sauce, thats suspect at best.
Some of you need to really think about how the hell you're gonna redirect an underground aquifer.
Did Musk invent a waterproof tunneling machine?
Fucking slide ass clowns man.
fcfa75 No.2250496
>>2250493
> e54c24
Possible kike shill bot this one, double posted itself on two separate anon's posts at once.
Even the (((shill))) algos are going haywire now LOL
fa085a No.2250497
>>2250493
Mirror. Accuse the enemy of what you are guilty of.
You learned well from your fellow member of the tribe. Saul Alinsky.
e54c24 No.2250498
>>2250491
Just desperate shilling attempts. The more normies they are able to turn away from the borad the better for these scumbags.
35d493 No.2250499
>>2250494
>Some of you need to really think about how the hell you're gonna redirect an underground aquifer.
*cough*fracking*cough*
879980 No.2250500
>>2250494
Thank you for confirming we are right over the mark.
19ef50 No.2250503
>>225049
Fracking doesn't redirect an aquifer, it destroys and contaminates it.
17 filters on you it's obvious clown.
bd7714 No.2250504
>>2250501
Thats bread with soup
a7b0c4 No.2250505
>>2250498
just lets us know we are on the right track!
72ea83 No.2250507
God bless you and keep you from harm, this day and forever.
fa085a No.2250509
>>2250494
You never saw the patent for the atomic powered tunneling machine? Really?
2962b0 No.2250510
>>2250498
So when the chips are down, the jew turns to black man appreciation spam and gore.
Weird fuckers.