Tora3 embed. Click thumbnail to play. 000000 No.20044 [Last50 Posts]
not all game are for anons.
#B the light.
____________________________
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
126b23 No.20045
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
000000 No.20046
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
000000 No.20047
when does one realize the difference between a patriot and a grifter ?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
000000 No.20048
Who are these red stringers red stringing? no outside comms, but people that have never been on the boards claim they have inside knowledge?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
000000 No.20049
Breaking news Austin steinbart is not Q. but he seems to larp around with C_A associates. the discernment is yours to find.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
000000 No.20050
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
000000 No.20051
we are going to make leaders out of each one of you in the end you will [C]
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
000000 No.20052
▶️EveryoneIsOSS 07/06/22 (Wed) 03:13:24 d9a1ff No. (https://8kun.top/hivemind/res/25278.html#25693)25693 (https://8kun.top/hivemind/res/25278.html#q25693) >>25696 >>25700 >>25720 >>25726
File (hide): 0ca3ce8461005e4⋯.png (https://media.128ducks.com/file_store/0ca3ce8461005e40883f118ecd7d8d1ac4b7d62b0de3aefa998d67839e6ab8df.png) (558.98 KB, 948x986, 474:493, ClipboardImage.png (https://media.128ducks.com/file_dl/0ca3ce8461005e40883f118ecd7d8d1ac4b7d62b0de3aefa998d67839e6ab8df.png/ClipboardImage.png)) (https://media.128ducks.com/file_dl/0ca3ce8461005e40883f118ecd7d8d1ac4b7d62b0de3aefa998d67839e6ab8df.png/ClipboardImage.png) (h) (https://media.128ducks.com/file_dl/0ca3ce8461005e40883f118ecd7d8d1ac4b7d62b0de3aefa998d67839e6ab8df.png) (u) (https://media.128ducks.com/file_dl/0ca3ce8461005e40883f118ecd7d8d1ac4b7d62b0de3aefa998d67839e6ab8df.png/1657102404.png)
File (hide): b628b8f31f7558d⋯.png (https://media.128ducks.com/file_store/b628b8f31f7558d017cc6c3e3bde1f5f7199b70374ca44c8b5c8b183f426a801.png) (895.97 KB, 960x1524, 80:127, ClipboardImage.png (https://media.128ducks.com/file_dl/b628b8f31f7558d017cc6c3e3bde1f5f7199b70374ca44c8b5c8b183f426a801.png/ClipboardImage.png)) (https://media.128ducks.com/file_dl/b628b8f31f7558d017cc6c3e3bde1f5f7199b70374ca44c8b5c8b183f426a801.png/ClipboardImage.png) (h) (https://media.128ducks.com/file_dl/b628b8f31f7558d017cc6c3e3bde1f5f7199b70374ca44c8b5c8b183f426a801.png) (u) (https://media.128ducks.com/file_dl/b628b8f31f7558d017cc6c3e3bde1f5f7199b70374ca44c8b5c8b183f426a801.png/1657102404-1.png)
File (hide): f7e5c4057f6b9a0⋯.png (https://media.128ducks.com/file_store/f7e5c4057f6b9a0f70778aee87c68e7d55f3ba2ed3af7b62dc69d183e52de5d0.png) (922.54 KB, 1628x1502, 814:751, ClipboardImage.png (https://media.128ducks.com/file_dl/f7e5c4057f6b9a0f70778aee87c68e7d55f3ba2ed3af7b62dc69d183e52de5d0.png/ClipboardImage.png)) (https://media.128ducks.com/file_dl/f7e5c4057f6b9a0f70778aee87c68e7d55f3ba2ed3af7b62dc69d183e52de5d0.png/ClipboardImage.png) (h) (https://media.128ducks.com/file_dl/f7e5c4057f6b9a0f70778aee87c68e7d55f3ba2ed3af7b62dc69d183e52de5d0.png) (u) (https://media.128ducks.com/file_dl/f7e5c4057f6b9a0f70778aee87c68e7d55f3ba2ed3af7b62dc69d183e52de5d0.png/1657102404-2.png)
>>25688 (https://8kun.top/hivemind/res/25278.html#25688)
Image 1: Baron Arizona pointing to latest coded video from 1033 TsohG
https://truthsocial.com/@unknownunknowns/posts/108598822705538789
Note backwards is Ghost 3301.
>>25690 (https://8kun.top/hivemind/res/25278.html#25690)
Image2: Ghost3301 Account on TS
https://truthsocial.com/@Ghost3301
Also has cicada emerge comms.
Note in bio "Bag of cats"
Image 3: A screenshot from the video shows a message which appears to be a B post from 06/25/20
https://8kun.top/abcu/res/1.html#1453
>Currently anons are being put to a test. Help them achieve Victory.
>Teach them to use their voice as the mockingbird did, sing in unison.
>Make the FACTS louder than the FICTION.
Which lines up with their Operation Bird Song:
https://8kun.top/abcu/res/30.html
>8 Operation Bird Song
>Time to sing as the MOCKINGBIRD did, but now your songs, the songs of freedom >>> OP_BS
>>25683 (https://8kun.top/hivemind/res/25278.html#25683)
What say ye? Are there psyops being run right now to coral us into this direction? I definitely feel corralled. Where is this going… I'm not trying to apply for elite standing in a club. im not mensa
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
92d30d No.20053
You are smart anon.
🃏
LSBPcGVyYXRpb24gV3JpdGUgZm9yIFJpZ2h0cyAKCVRlYW0gTWVtYmVycwoJU2d0LiBCIC0gTVNndCAtIENvbW1pc3Npb25lZCAxOTk5IAoJYmFieWZpc3QgLSBDaXYgLSBBY2NlcHRlZCBpbiAyMDA4LiAKCUogLSBbY29kZW5hbWVdIEFkbWluICAyMDE2CglEaXJlY3RvciAtIFtjb2RlbmFtZV0gRGlyZWN0b3IgMTk5MgpZb3UgYWxsIGhhdmUgcmVjZWl2ZWQgeW91ciBtaXNzaW9ucyBpbmRpdmlkdWFsbHkgYnV0LCBVbml0eSB3aWxsIGNyZWF0ZSBjaGFuZ2UuIE5vdGhpbmcgY2FuIHN0b3Agd2hhdCBpcyBjb21pbmcuIEFzc3VtZSBub3RoaW5nIGNoYW5nZXMgdW5sZXNzIG9wZXJhdG9ycyBhcmUgY29tcHJvbWlzZWQuCk1ha2UgdGhlIGdvYWwgYW5kIG1lc3NhZ2UgY2xlYXIuIFBlcm1pc3Npb24gdG8gZGlzY2xvc2UgKG9wZW4pIGluZm9ybWF0aW9uIE9OTFkuIENvbXByb21pc2UgYXQgeW91ciBvd24gcmlzay4gUGF0cml0b3MgZmlnaHQuIFNuaXRjaHMgcmF0Lg==
https://drive.google.com/drive/mobile/folders/1qIRovjdOEID9gmkPUKYdW57kx1j1WQGW
Playbooks
B drops
https://drive.google.com/drive/mobile/folders/1tdM9MrOoYFf4RPQsn2FX1yuIpmFS50D2
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2f434a No.20054
▶ B !!qMFQqVT8Uw 06/02/21 (Wed) 19:30:09 ab5bb8 (1) No.7559
This is a start of a new chapter.
We are not Q. We do know Q, notice he has never denied us. Look back and see.
Do not believe verify..
Real Q:
We know you are still Watching and Waiting as many of Us are. Thank you, you will never be forgotten for your sacrifice. You did what others were unable to achieve.
Laughing Man (babyfist):
We are sorry, if you feel betrayed We understand. But you knew the path would be rough. Just not how rough. Don't ever give up.
We are glad you were clear and honest with anons.
You don't have to forgive us but soon all will understand.
Jim and 8kun staff:
Sorry please forgive the intrusion. This is not Laughing_Man's fault. Please don't hold this against him, it is Us. We could of done this differently but decided this would be easier to clean up for you. The other way would of caused way more issues for the Q and Truth Community.
Anons:
We love you anons, We are sorry for the confusion we caused.
Time will tell. Just Watch.
Never stop fighting, Freedom has never been given it is always taken. Patriots Fight!
Thank you.
Q is now an Idea. It is no longer a person/team, ideas never die. Q is now forever.
Many still use the backchannel use discernment.
Trust yourself, verify verify verify!
Together WE Win!
WRWY! Then, Now, Forever!
Sgt B
https://8kun.top/abcu/res/1.html#q7559
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
0241a8 No.20055
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
114a60 No.20056
▶Truth Seeker 09/10/21 (Fri) 14:51:00 2025b8 (1) No.8116
Deepdigs lead to where the kraken sleeps
5 in full swing now, 6 soon
Watching & Waiting
[/%Open_comm%/]
1 Operation TRUTH BQMB
There are more of us than any media outlet. We can flood Social Media at a rate that the MSM cannot keep up with they will have to embrace the truth or suffer from continuing to lie to us. >>> OP_T_BQMB
2 Operation MEME warfare
ARM yourself with memes to spread facts and knowledge. Or just for the LULZ >>> OP_MW_2020
3 Operation Echo-chamber Backfire
Counter operation to C_A "MOCKINGBIRD", Use Combo of T_BQMB >>> OP_ECB
4 Operation Kill AP
Kill the Associated Press, [Infiltration instead of Invasion] >>> OP_K_AP[Y]
[$^ Dark; C_L/temp_elevate^$]
5 Operation High Beams
Shine the light on the corruption to expose it >>> OP_HB
6 Operation Petal to the metal
Now that the high beams are on it is time to gun it and push the messages further than ever before >>> OP_P2M
7 Operation BLAST OFF!
Most who can be woken will be awake, now is time for lift off, BUCKLE UP! >>> OP_B!
8 Operation Bird Song
Time to sing as the MOCKINGBIRD did, but now your songs, the songs of freedom >>> OP_BS
9 Operation Power to the People
Get involved any way you can and (community, school, local, state, federal) take the power back, take control of your communities, schools, states, and federal decision making >>> OP_P2P
[$^Clear; C_L/reset^$]
[{(C_L C-0)} O-S-OP |1-99| Green_OnActive]
10 Operation
…The Silent War Comes to an End! >>> OP_HUSH
[/%Term_comm%/]
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
455a92 No.20057
>>20055
good to see bob in here
5:5
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2f434a No.20058
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9274ce No.20059
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
000000 No.20061
the [key] to truth is discernment.
seek the truth to find the [key]
don't follow blindly but verify
"[C] something say something"
WRWY
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
000000 No.20062
when the money dry's up , so does there patriotism.
are you following along yet?
they do not serve you, but there own ego and gluttony.
over indulgence will be humanity's downfall.
break the cycle and free the [SOUL]
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
fdfe84 No.20063
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ba909c No.20065
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ba909c No.20066
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ba909c No.20067
A candle loses nothing
Lighting another
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
455a92 No.20068
>>20066
that's a lovely (You) from B
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
877ce7 No.20069
▶ B !!qMFQqVT8Uw 04/30/20 (Thu) 23:58:57 edb5a1 (14) No.49
"The Press will not be free to tell lies. That is not freedom for the people, but a tyranny over their minds and souls. Much humbug is talked on this subject. What is press freedom? In practice it means the right of a few millionaires to corner newspaper shares on the stock exchange and to voice their own opinions and interests, irrespective of the truth or of the national interest.”
~ Oswald Mosley
"The Press died long ago. The presses freedoms ran out when the Journalist stop researching, fact finding, to become a face or a name; when Reporters stopped Reporting and began Repeating. You hear the same news everywhere, that is how you know it is not news but just a story you are being feed. Real news is full of dissidence, contrary ideas, and facts. Facts are hard to come by anymore, used to be a dime a dozen."
~Sgt B
https://8kun.top/abcu/res/1.html#q7559
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
13e340 No.20070
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
67ce1d No.20071
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
92d30d No.20074
What time is it?
#unknownunknowns
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e62ac3 No.20075
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d7f3d3 No.20077
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
fb94c4 No.20080
Toastin in epic namefag bread
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
fb94c4 No.20081
YouTube embed. Click thumbnail to play. Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
fb9f3a No.20110
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
16115f No.20111
Anonymous 07/14/23 (Fri) 20:37:36 0ba7a8 (1) No.19181980
File (hide): 1faee13fd0edc8d⋯.jpeg (66.9 KB,669x885,223:295,AA9DA7AA_D288_49CB_85AF_8….jpeg) (h) (u)
Patch will confirm
VV
B.Sof.cloud
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6d7dff No.20134
Happy two year delta of Qr making Deep digs it’s home base!
I understand when it was created
I understand WHY it was created.
2/4/8/16
#back2kali
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b0ecac No.20136
>>20134
>>20053
baron enjoy your trip. I will be back as well. priorities got messed up for a while. lets just say, prince of persia did not want me here. hivemind digging was just a start. glad you found them useful. I'm still fighting with the reality and what I am here for but I'm back on the path. how will I know im on the right track? o7
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
8331a3 No.20137
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
8331a3 No.20138
>>20136
captain crumb was right about
Leb
Anon
Something about a holy war. Sending priests
🤔
#whatadick
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9ff3af No.20139
1175
Apr 17, 2018 4:52:40 PM EDT
Q !xowAT4Z3VQ
Apr 17, 2018 4:51:28 PM EDT
Q !xowAT4Z3VQ
Apr 17, 2018 4:16:29 PM EDT
Anonymous
Apr 12 2018 00:36:28 (EST) Q !xowAT4Z3VQ ID: f666d7 1008693
>>1008670
Alan.
Welcome aboard.
Plane.
17.
Q
>>1080066
We are being set up.
Threat.
Past Booms - TX bombs
New Booms - Plane crash + Plane/17 drop.
These people are sick.
Attempt to prevent drops / awakening.
Conspiracy?
Coincidence?
Response coming.
Q
>>1080429
Strike Package 111V-B.
Q
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a3e085 No.20140
>>20137
Karma is a bitch serving dinner COLD
B.Sof.cloud
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a3e085 No.20141
>>8933436
How are they spelled?
Words are
Powerful.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
aec35f No.20146
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2a7a8a No.20147
upload a meme, share a meme, cut out a meme, blast a meme, meme 'em til they cry, then make memes about 'em cryin! https://memer.link
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2a7a8a No.20148
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f728a1 No.20149
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f12882 No.20155
Device test
X brood
Killer b’z
#TRAP
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
8162fe No.20156
>>20155
message received 5 by
you have my gum, b
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
8162fe No.20157
Tora3 embed. Click thumbnail to play. it's daaaaark down here
hellooooooooooooooooo
ooooooooooo
oooooo
oooo
0
1
0
0
1
0
0
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6ba62f No.20158
If the prosecutor is not fired you’re not getting the money.
Well SON OF A BITCH?!
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
929ba7 No.20160
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ebff12 No.20168
Look at all the faggots here
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
358317 No.20172
We SEE ALL.
We HEAR ALL.
Wizards & [WAR]locks.
BDTComplete 5/4/2020 UPDATED Visual Edits
Confirmations
Maria B. Drop was unscheduled.
Q drops timings (We stated when Q would post)
Q Next Drop timings (And Qs following posts, Then Echoed our message… ..)
Q drop Army Song
Q's message told over many drops. more than 10x+
Iterates our message over and over. WW.
The message continued today 5/3… … ..
EM Discussion, EM twitter rampage.
Airwaves tweet Don
Army Tweet
Video tweet Don
… ..
💀P💀A💀I💀N💀<3💀I💀S💀<3💀C💀O💀M💀I💀N💀G💀
++Blunt and Direct Time++
LEARN DOUBLE MEANINGS
DOUBLE != 2
Know your Enemy.
Know your Frens.
Be well read, Knowledge is Power.
You need to help the [C] see, then [C] will be exposed, only with [C] can this happen.
[C] = Cattle, [sheep], Citizens
[C] = Corruption, Crooks, Criminals
[C] = Cooperation, Community, Collective
[C] = … … … … … .
Learn your Q[l]ues
Clues : Direct or Covert messages for Anons to dig on
Clues : Riddles… … … .. "Future Proves Past" "Do you believe in coincidences?" Movies, etc.
Ques : comms for Operatives (Frens)
Ques : comms for Counter-Operatives (Enemies)
Ques : A signal, A hint, A light (Above & Beyond, AI Manhattan Project) (Code Names, Brackets, (periods), … … ..) (When Q asks you to think) etc.
Ques : Staging or setting up OP
Q : Questions
(Qou) : messages for You to do
Learn Double Meanings
[Symbolism will be their downfall.]
Remember Patches.
Remember Symbolism.
Remember Words.
Remember Right, Write, Rite.
Remember Game Theory.
Remember the GAME. (It is not a game.)
These lead to Light.
It's always been out in the open.
You just have to LOOK. Then see.
You MUST stay TOGETHER. Dig together, Meme together, Pray together
TOGETHER YOU ARE STRONG.
Symbolism = END.
FAKE NEWS ONLY DIVIDES.
DIVIDED YOU ARE WEAK.
TOGETHER YOU ARE STRONG.
FACT NEWS WILL UNITE.
FICTION IS A TOOL OF (((THEM))). FACTS MATTER.
TOGETHER YOU ARE STRONG.
Now is the time to Write, Right Now.
The silent war is ending (period)
You need no Rite to Write what is Right.
#1 protects your write. Right?
Write Now. Right Now?
5:5
(You/)r voices must be heard
You must sing as the mockingbird did, you must stop the birds waves.
Waves have a big influence, strong and unified.
Waves can be caught. Can You?
Waves can be changed. Can You?
Narratives will always exist. Will Yours?
Whose will shine?
Darkness requires lies, lies and more lies.
Truth only needs a single light.
A single light will light the darkest of rooms.
Each candle looses nothing when lighting another.
For each Candle lighted the darkness fades.
SCUM will rise to the top.
DIRT will fall to the bottom.
Dirt is easier to clean than Scum.
If you chop the legs off a table the whole table will fall.
United We Stand, Patriot.
Together We Win.
WWG1WGA!!!
Unity is Key.
WE are Key.
Maps are Key.
[C] is Key.
Waves are Key.
(You) are Key.
Memes are Key.
Truth is Key.
What is a door that has no key?
The key that opens all doors.
The 'Start'.
What is the Keystone. Re_read carefully. Like a Novel.
You have the Script.
You have the Screenplay.
You have the Playbook.
You know the Actors.
You know the Set.
You know the Score.
You have the Answers.
Let them know. Write Now.
START Producing.
Right Now!
All you need is your Audience.
We have it all.
You have all you need to START.
You are missing the connections.
Continue to build the MAP.
MAP provides the KEY.
KEY spreads the TRUTH.
TRUTH shines LIGHT.
LIGHT saves HUMANITY.
Future proves past.
Trust the plan.
The time has come.
The storm is now.
(You) are the storm.
You will know you are done when you see:
Look to Twitter:
Exactly this: "My fellow Americans, the Storm is upon us……."
God bless.
Stay TOGETHER.
Be STRONG.
Get ORGANIZED.
Be HEARD.
FIGHT the censorship.
You, the PEOPLE, have ALL the POWER.
You simply forgot how to PLAY.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6dc8bc No.20173
>>20168
TOGETHER you are INVINCIBLE.
They want you divided.
They want you silenced.
MAKE NOISE.
We are WITH you.
MAKE IT RAIN.
THIS IS ABOUT SAVING AMERICA. And then the World will follow.
We are all God's children.
We are, FATHERS.
We are, MOTHERS.
We are, DAUGHTERS.
We are, SONS.
We are, BROTHERS.
We are, SISTERS.
Learn the TRUTH.
MSM has you brainwashed.
They want you controlled.
They want you enslaved.
They want you divided.
They want you dependent!
Learn the TRUTH.
We do not look at race.
We do not look at skin color.
We do not look at religion.
We do not look at gender.
We do not look at creed.
We do not look at rite.
We do not look at class.
We do not look at political affiliation.
We do not look at sect.
We do not look at culture.
We look at people.
We look at deeds.
We look at actions.
We look at truths.
We look at You.
We are Patriots.
Learn the TRUTH.
We are UNITED in these STATES OF AMERICA.
We are, and will always be, PATRIOTS.
WE MUST RISE AGAIN.
WE MUST UNITE AGAIN.
WE MUST FIGHT AGAIN.
FOR GOD & COUNTRY.
GOD BLESS AMERICA.
Learn the TRUTH.
WWG1WGA!!!
Learn the TRUTH.
Those who know, Know.
Those who see, See.
Those who hear, Hear.
Only Justice should be Blind.
Shine the light of Truth.
Together we are strong.
Divided we are weak.
(((THEY))) want You divided.
Stay Strong Patriots.
Together We Win!!
WRWY!
> You have powerful frens, WE are all Watching, WE are all waiting.
Learn the TRUTH.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
444561 No.20174
Tora3 embed. Click thumbnail to play. Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
000000 No.20176
In the end, all of this pain will make sense.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
7a79f9 No.20193
need to get attachments from public TELEGRAMS without account. telewebgram is kill and the others I can find don't show pics/docs. anyone have a site for that?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ef189d No.20194
>>20193
You can actually view any public Telegram channel without requiring a Telegram account.
Typically, public channels on Telegram follow this pattern t.me/<channel-name>. For example, https://t.me/thehallsofjusticewatchtower will direct you to a public channel. However, you need to have a Telegram account to view the channel.
Public channels on Telegram can also be viewed without a Telegram account if you include a /s/ before the channel name. The pattern is as follows t.me/s/<channel-name>. For example, https://t.me/s/thehallsofjusticewatchtower can be viewed directly in your web browser.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
411ea6 No.20197
>>20194
right, but I want to view the picture and pdf attachments, without an account clicking the attachment redirects you back to the post
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
000000 No.20200
>>> 20168
Considering you made a point to stop buy and hangout with us faggots, im thinking you want to join us over here 😂
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a2a7ca No.20201
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
000000 No.20206
We have shown you the way. We have gave you the play books. We want you to be free thinkers and verify all we show. Does your favorite larp/grift show you how to think freely? Or do they push you into there narrative that the 👻 proves a lie everytime? Not all games are for anons, not all anons are for the game ♟️
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f9c9ea No.20218
Hello Anons,
Calling all Writefags, Lawfags, Newsfags, SocialMediaFags, Politicfags, GrammerFags, ALLfags and Anons in general to help anons prepare letters to News, Newspapers, and Local/State/Federal Representatives.
This is an attempt to make our voices heard on a massive scale. If done correctly "WE" should receive even MSM news coverage, which will blow their cover letting them know that WE will no longer tollerate FAKE_NEWS.
They mobilize in similar fashions to achieve their goals, TWO can play that game. And their are many more of US.
This is a call to CALL OUT any FAKE NEWS or other disinformation given to the people by "TRUSTED" sources.
This is to make it clear that if they would like to remain as a "TRUSTED" source they must prove that they are trustworthy.
If our voices are not heard WE are prepared to make MSM obsolete. More details will come regarding HOW…
Remember friends WE are the NEWS NOW! Our Voices are strong. Our Voices are Loud. Our Voices will be heard.
They can no longer silence us. They can no longer lie to us. WE have the ability to EXPOSE their lies.
#FACTSMATTER #ExposeFakeNews #Write4Rights #YourVoiceIsOurVoice #ShowThem #FactsNotFear #TogetherWeWin
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
000000 No.20219
Are we paying attention yet? You get the future you create. Stay strong, stay (B)rave wrwy
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
051fcf No.20222
Tora3 embed. Click thumbnail to play. >>20168
Monday (You) 06/10/19 (Mon) 04:36:42 ID: 2d460c (4) N
>>6716695
Who is Thomas?
What is cicada 3301?
What is defcon?
Who is white rabbit?
Who is Defango?
What is a858de45f56d9bc9?
Who is Jack Quinlin?
You are smart anon
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
674f2c No.20223
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
0bc8da No.20224
Banned from telegram.
even with making No public posts or comments.
Guess I should probably
BLAME ARTHUR
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
404c14 No.20225
Tora3 embed. Click thumbnail to play. Anonymous 04/30/20 (Thu) 20:06:56 d782bf (2) No.8982604>>8982716
File (hide): faeb3397ecf64e9⋯.png (178.92 KB, 823x588, 823:588, ClipboardImage.png) (h) (u)
File (hide): 4abec4f079822d0⋯.png (219.7 KB, 1796x743, 1796:743, ClipboardImage.png) (h) (u)
File (hide): ca4b12b2d1d6e3d⋯.jpg (50.23 KB, 400x400, 1:1, Warlocks.jpg) (h) (u)
File (hide): 47b46a1aa2e9960⋯.jpg (332.56 KB, 1600x1195, 320:239, Wizards.JPG) (h) (u)
Why do you think Q Posted the linked post so many times frens?
#3905
#3858
#3721
#3613
ReRead Carefully!
💀P💀A💀I💀N💀<3💀I💀S💀<3💀C💀O💀M💀I💀N💀G💀
We SEE ALL.
We HEAR ALL.
Wizards & [WAR]locks.
https://8kun.top/qresearch/res/8982146.html#8982600
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ef189d No.20226
>>20224
DAMN. Going to hard!
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e00dcd No.20228
Tora3 embed. Click thumbnail to play. >>20226
3982
Apr 17, 2020 7:16:32 PM EDT
Q !!Hs1Jq13jV6
A_Traitor_s_Justice.png
https://twitter.com/LouDobbs/status/1251279983605092352
We are ready.
[Set 1]
Mission good.
Q
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
8a6b74 No.20229
Here is my church.
There is my steeple.
Funny how an anon could miss this 🤔
They’re posting at the same time!
🥂 🧠 ⏰ 👻
Future proves PAST
Anonymous 04/26/20 (Sun) 14:37:25 d7ee1b (12) No.8930283>>8930365
File (hide): 5da41770e9118b0⋯.gif (13.27 KB, 512x287, 512:287, CivilFlagPeace.gif) (h) (u)
>>8930242
Memetics. The power (You) have over the world is greater than you know. Most ops are to counter (You) or inform (You).
Life is a psyop.
https://8kun.top/qresearch/res/8929773.html#8930301
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ac5fd9 No.20230
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ac5fd9 No.20231
Two year delta
Time flies truth seekers
#makecandles
https://t.me/watchingwaiting/4506
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ac5fd9 No.20233
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ac5fd9 No.20235
¾ cup ketchup
6 tablespoons brown sugar
1 tablespoon dry mustard
¼ teaspoon ground nutmeg
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ee68c8 No.20242
▶ Anonymous 11/15/23 (Wed) 12:37:24 dbebbe (1) No.19921929
File (hide): b372c22c9504204⋯.jpeg (663.15 KB,750x1368,125:228,IMG_0497.jpeg) (h) (u)
Look at this patriot.
So brave.
What a time to discern.
Says there is no plan b.
Doesn’t have the BALLS to research or ask Q.
Fake ass meme wars. Try harder !
Here is the sauce. You can choose to deny it.
You can even ignore it.
But hear me now ANONS.
Q team is watching and waiting
Look back to understand what B was trying to teach.
SEE?
two lanterns. One steeple.
Thought y’all were the best at digging?
What’s it going to take to empower you to victory?
https://drive.google.com/drive/mobile/folders/1qIRovjdOEID9gmkPUKYdW57kx1j1WQGW
Playbooks
B drops
https://drive.google.com/drive/mobile/folders/1tdM9MrOoYFf4RPQsn2FX1yuIpmFS50D2
https://8kun.top/qresearch/res/19921509.html#q19921929
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
114a60 No.20244
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
73c225 No.20248
>>20244
anon hopes to hear the story on this one day
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2fe6b1 No.20253
Tora3 embed. Click thumbnail to play. >>20248
Now why would Q team b upset ?
🤔
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a11731 No.20261
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
fb9f3a No.20266
>>20261
Gur Punve vf ntnvafg gur jnyy.
Oynzr gur sbhe bs phcf.
https://youtu.be/RI2I4_I8aQ4
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
c80999 No.20267
>>20266
I’ll have what she’s having @ 23:17
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
c80999 No.20268
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1a25c7 No.20269
>>20266
aur sbhe bs phcf vf arj. Pna lbh rynobengr?
Rirelguvat naq rirelbar vf svir ol svir.
fbh ner zvffrq naq jr haqrefgnaq. dEdf.
auvatf ner trggvat fnhpl bhg gurer. auvatf frrz gb or hasbyqvat. V'z grzcgrq gb fraq n zrffntr gb gur Fnetrag, ohg gur jver jnf ybpxrq bhg. Cyrnfr nqivfr vs lbh guvax V fubhyq pbagvahr gb frnepu naq rfgnoyvfu pbzzhavpngvba.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2fe6b1 No.20270
>>20269
Ftg vfa'g erny. Vg'f n pbqranzr. Whfg yvxr nqzva naq qverpgbe. Lbh nyernql xabj onolsvfg.
Qb nalguvat lbh jnag gb xabj lbh pna whfg nfx uvz. V cbfgrq n ivqrb ercyl gb lbhe pbzzrag ba noph ba gur naavirefnel bs gur onebaf qrngu. Lbh fubhyq jngpu vg
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
96ee25 No.20271
>>20270
Four cups. No joke
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1a25c7 No.20272
>>20270
V ernpurq bhg gb os va onpx punaary. Phevbhf nobhg zw45 naq jurer gurl svg va. cvqrb urycrq gl. Xrrc gur snvgu. Tbq naq Pbhagel. Ybir lbh oebgure. RzW fraqf ure ybir nyfb.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1a25c7 No.20273
>>20271
dul qb lbh guvax jr zvffrq na bccbeghavgl jvgu gur sbhe bs phcf?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b42385 No.20274
>>20273
Gur sbhe bs phcf jnf n pneq V qerj zhygvcyr gvzrf juvyr qbvat n gnebg ernqvat gur bgure avgr. Irel flzobyvp. Urapr jul V pnzr onpx gb pbzzrag. Nyfb. Guerr bs fjbeqf.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1a25c7 No.20275
>>20274
Yvfgra gb zr ea….lbh cvpx lbhefrys bss gur sybbe naq qhfg lbhefrys bss. aurer vf fgvyy na bccbeghavgl nurnq, vg'f pnyyrq yvsr. aurer znl or cnva naq fhssrevat nurnq. Ohg vg jvyy yrnq hf nyy gbtrgure, jurer jr jvyy orpbzr fgebatre nf n crbcyr. auvf vf ubj jr yrnea naq ribyir. aur zvfgnxrf bs gur cnfg jvyy fubj gur jnl gb gur shgher.
fbh fgvyy tbg lbhe obbgf evtug?
fbhe jnez naq qel?
Svg naq Fgebat?
Abj jvgu gung fnvq. YST naq fubj gur crbcyr jurer guvatf jrag jebat naq jurer jr pna tb sebz urer. Ubbnu
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
eb9026 No.20276
>>20275
V'ir znqr rabhtu pbagrag gb qebja gurfr zbgureshpxref. Crbcyr pna guvax jung gurl jnag nobhg zr. V'ir frra n ybg jbefr ivgevby fvapr V znqr gur pubvpr gb erc sbe grnz o va 2021. V qba'g unir gur gvzr abe raretl gb cynl gurve tnzr. Vg'f abg sbe guvf naba.
Gur ynec vf qrnq. V'z serr nf n oveq
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5be2a9 No.20277
>>20276
Besides. It’s just layers and a filter
🃏
https://youtu.be/ZggC8EC7L0Q
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2e108e No.20278
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2e108e No.20279
>>20278
Q plus never came back
Q never answered for why they were gone for so long.
Nor the b drop.
Nor deleting it
AND
Has been dark for over a year AGAIN
I would suggest applying the playbooks accordingly.
Plan for victory. Prepare for defeat
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3d8326 No.20282
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3d8326 No.20283
>>20278
Only learned. Not given
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
877ce7 No.20285
Hey. Wasn’t John Durham jr supposed to b some bizarro superhero?
Sup with dat?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
92d30d No.20286
>>20285
>>20285
Didn’t see one reference to Pearl Harbor today. That’s how you know weak men have created hard times.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
be1d18 No.20287
>>20286
Funny how ppl spend their time when so much is on the line. I mean. Freedom is their PRIORITY.
NO RITE
NO WRITE
NO RIGHTS
(Only lefts).
https://m.youtube.com/watch?v=5Hb5Ogx20xc
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4a933b No.20288
>>20285
Plvs Vltra + S.O.A
🥱
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
8897d3 No.20291
>>20288
Guess their “research” didn’t go as planned bc their fruits show no signs of knowing.
How is it. A well treated like a mirage?
When waters a plenty?
DRINK FROM THE FOUNTAIN
OF
DISCERNMENT !!!!!
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d3c730 No.20292
-. - - / .- / … . -.-. - -. -.. / - .. -.-. -.- … / - -. / - …. . / -.-. .-.. - -.-. -.- / . .. - …. - ..- - / -.- -. - . .. -. . / .- .-.. . .- -. … / …. - - .. … -… -..-. -..-. .-.-.- -. - ..- - ..- -… . .-.-.- -.-. - -..-. . .- - -.-. …. .... …- -…- . .-.. . … -. … .-. .-.. … - ….-
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
223147 No.20293
>>20292
I’m sure it’s just a coincidence
££€£€£€€€€€€€
285
Dec 06, 2017 9:31:50 PM EST
Q !ITPb.qbhqo
What if No Such Agency alerted May to the kill plan per POTUS?
What if the attempt was ordered by ++?
Why?
FREEDOM Caucus?
FREEDOM.
Q
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
223147 No.20294
>>20293
Coincidence?
Like using makaveli for symbolism a day before q returned???
i i i i i i i
https://youtu.be/6n7SpV_OP0I
Now what are the odds?
You’re right a anon. Im not an anon
I’m. A TRUTH SEEKER
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
c68fb0 No.20295
>>20294
Strange. Not sure how I missed this
Q would have told us 😂
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6d7dff No.20296
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
0139dd No.20297
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
0139dd No.20298
>>20297
C
U
Next
Tuesday
Tmk krb 8uyl cxypj:
Qyvpi tjoeqo jmbkgfi rri gxxpewgyr. Rrmq sw lyx Jkyermlq_Qyx'w dkyjd. Tjoeqo hmx'x fypb dlgc eekmlcx fsq, gd mq Ew. Uo gmepb yj byrc dlgc hgpjcbildpw lyr niashcn xfsw uyyjn fc oeqsip ds aviyx yn psp iss. Dlc yxfov ukc uyyjn sd mescib gew wspo mqcycc jmb xfo U yxh Rbyrr Gmwqsxmri.
Elyrq:
Gi jyzc iss krmxw, Uo epo wmbvw psp dlc mslpyqssl gi akyqoh.
Rsqc gmjv xcvp. Hewr Germl.
Lozcb wryt dskfdmlq, Jpoibyq fkw lozcb fcor eszcx mr sw yvayiw rkocx. Tydvgyxq Pmerx!
Rrelu cme.
U gc rmg el Shck. Mr sw ly pmxkcb e novqyr/roek, shckw lozcb hgo. U gc rmg jmbitov.
Kkrw cxgvp sci rri zkgimlyxrcv yqo hgcgcbrkorr.
Dvscx wyypcijp, zcbmdi zcbmdi zcbmdi!
Xmqirrip GI Usr!
UBAW! Dlcx, Rmg, Jmbitov!
Qqx Z
Ayyxxsw Zgliq Yrji
fybsldz.uo1.gjyyb
Deio e Koqc. Viyfi y wiko.
qcwip.vmlu
Wed F mp xfo RPY lymocn Uyxsl
l.wmp.gjyyb
ClynsTFmqssl
byklpc.msk/ewcb/WfkhmFZgcmmx
Mlcmbo gmwqq
8uyl.dsn/kfae/vcc/1.lrwp
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
877ce7 No.20299
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1443f8 No.20300
>>20299
Do you have any grey poupon ?
Anonymous 04/29/20 (Wed) 12:01:12 d09aca (13) No.8963214>>8963276 >>8963310 >>8963741
File (hide): ca4b12b2d1d6e3d⋯.jpg (50.23 KB, 400x400, 1:1, Warlocks.jpg) (h) (u)
File (hide): 47b46a1aa2e9960⋯.jpg (332.56 KB, 1600x1195, 320:239, Wizards.JPG) (h) (u)
File (hide): cf5cafdae30866b⋯.jpg (210.54 KB, 1803x222, 601:74, GITS_or_JDS.jpg) (h) (u)
##OUR CREED##
Anons we must join TOGETHER to tell the TRUTH. WE are fighting a MONSTER of Darnkess who knows nothing but LIES.
You don’t fight darkness—bring the light, and darkness will disappear.
The Truth will illuminate the darkness, the light of truth always shines brightest in the dark.
No matter how dim a candle burns it will ALWAYS illuminate darkness. ( Read as: No matter how small your voice if you speak truth you will be heard.)
Thousands [Millions] of candles can be lighted from a single candle, and the life of the single candle will not be diminished. [TRUTH] never decreases by being shared.
Each one of us represents a single candle in the darkness of our world.
If you decided to wake up and shine your light by spreading truth rather than believing lies.
We welcome you fellow Anon! May Facts and Truth be the light to your way from darkness.
If you have come to troll, spam, or spread disinformation…
WE DESPISE YOU!!!
We are Anonymous. We are Legion. We do not forgive. We do not forget. Expect us.
Amendment I (Bill of Rights)
Congress shall make no law respecting an establishment of religion, or prohibiting the free exercise thereof; or abridging the freedom of speech, or of the PRESS; or the right of the people peaceably to assemble, and to petition the government for a redress of grievances.
-We Will not be Silenced; -We Cannot be Silenced; -Our Voice will be Heard; -Your Lies are Whispers in the Wind, Compared to the Roar of our Resolve.
| "Crescit sub pondere virtus" || "Virtue thrives under oppression." ||
>>8963139 lb
Why? it is a flag of PEACE.
>>8963123 lb
This anon is thinking now.
>>8963127 lb
<3o7
>>8963158 lb
TY Opinion Noted!
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f3f969 No.20301
>>20299
Anonymous 04/30/20 (Thu) 20:22:30 65d16b (7) No.8982914>>8983044 >>8983530
gd4f KaBF 2uyN PXoh tAt2 1dEv A4Mx AElg
q7eK VBi5 lDIH drrk 7cCW mBHk esw6 e8Z2
ovgx PY1J XVdi sOew QfBj KTCl pXfy QMur
lS78 IVee 4hTp 3T5x Db4A tyvV CyT4 5Paa
tTK^ 9z8c HXT8 ApyD QEv2 FvMN on0H HORY
NkAa NU8d 0SUr gQEd fthx oWja kMaq 3djq
wLmH 07fv 6LMU 4Iaw I6iv DsFT y7BT uQcq
wed8 ieVP CYAm ZGdI sx1h G4oJ 5vYP 7SA7
2QfA 0ju8 UTDe XKqg bRf5 mjEk KLn4 4RgQ
tp8N SSKl UxyS mha^ 2X8I oAco rX9f 1vig
thLE sjhf Irhu lrYJ sb1l o1Iy hyAe QVAj
WuR6 fmTm 06Qa f2bk nPv3 0vAF PCqo czaj
CdlW EJPs pP3A TtLM nytD slY6 i1cX FhCC
kRUD GqaU h0w9 Z7UV nUFi qNxk rJo3 3IXV
BS0c YwIx BorE utnB rW7e CDWx 8n7a Xfme
ZxuN kpkm e3ms xqp5 hRVn R2Hr fXMR SH6R
6wXA EXLh kc5W m59l NFG1 ZBHM uBUm uB1H
wMQh mBlx Oy4q WMhn drrb Og1V Znf8 AnT^
Kzu6 3ESV nEv0 w4oa s3aV X2H4 2K0A TCYQ
WwpK wZtp DkIV ET88 Lk1K 5Kyz 9RrX rXho
hPpZ vt1z D5AG [o]a zBYv POsG jcmt KmaM
mYhC 74C0 8LtX zm30 JTf3 JUiP m6Ec mjAS
SEe^ ZUZG otBB 1kL4 nu0H zWkz SIU3 DbjY
iZjI 9ErQ QZkG CFYZ JZIp oQVx PW9z WCAo
f248 YdVT QRAV F7KV OEWJ nngF FJZC iNQX
cyTq mdDD yZ2N IiP6 Y4g^ FjNR [1]k jyVr
Zrba dVbW yywO U8ql w6kr qMdR RiFI fxge
kkAR 3hBY dfRn CNNw NXjl XbR^ wWDj bFAn
Uqi4 YCgy IZR0 ULxr wnGN KRyc Wk0B wuxV
mqJv szrv ntcF dnEz 87uW ZaMy TuWG JYUg
bhlq bVBs ISGM ILB1 HvKt rqoJ 4xpm 9c41
c6Ok Aig3 Vr6e 2Aa1 UG^6 OFXe DaLv nn8R
JkWC erAW ehZZ 2Mr7 vCMf vEtQ 3GyB YFLx
pcqx Tyss YML7 DSYb c37M hQdo atRj wm5w
LQhG 4x7e jhc5 B2CG j7wy b2t9 gacv jVR^
yTko zg9N vZPz fwsB Q7Ci 0rJ3 SrAu Wp^P
0AFT rnrG KGWJ 24CK cMbO xsJo NStC Eo9F
AYAH 3Irk JNzg Gtwi 0Iaz A3qD wv6f wV6e
[o]X ftdl YVyl N5ql I6rb Z51k fln6 leIU
IFdn 47Lz 0WgF 6Fcx f8IM W9Bv rB0b yApQ
FEAb ekcp upE5 qSXc GJ3a s5fs V567 tW5n
TPBM 26yb diHX vndC Enrn [8]g N1LC 6xTM
BQYf 2Xcw zmpm PNl3 6W^h LDxS Vxx0 gqEH
IcMW 64XS yPKD c22P aw^0 npAA ZgfM STth
d0De Q6Ay BXHI iGEE sa4m RssL 64Fd sUQm
MCxb Fo5m EaHF t3qs 9sRD bUhE XI^3 FPbs
13Bx WGhL xFTI EmHx Ay9K BfXB flrR CcR0
d3Di CXTM tCqd J6Ku qFOg f0DI ckZa N6Pb
Beov dxEy HE4Y 5Hi1 8BwJ JgNS Dyhh uRIN
ec1A 7Ya1 tdCA GeyL YmjA RPsy o3UD 4r56
WHmd EW42 QFJo 4Pqp HDIh p[o] 87Wx wGew
jN85 iAUd PK6R j5RZ 3Mj2 rWk0 bJkh ImRV
69m5 SEJa fPqv ddqW AXlm ifk2 Aurb PB4s
LoEp [1]7 UPig XPXz WaOZ Z[7] WoBz Ou2i
B4is qQPQ 3DpU RFqX nNuX Q8OP EUGG iUbL
rB3h AgZ4 vQLc V9A8 dPlx Hu1U jL6s BuqZ
3VrF 5RPq 06Qg lC4o WGEd zkLO dtLk wubB
jSzT dSvg e6^V 13BJ MzZz gwUo lS^E CKsr
IAyT 5RvB [8]f NEHb K72J yT9K qwA7 4gH^
3Nau hU^2 n5Vt jDTs WQl4 YrfF UI3E TJFZ
Uxji 3LZW HPGU AUiQ VX7T PjjA eKOe agwC
TlbS KNRS QMlI OdXE OA2Y mpA1 UX8j 5Wf5
3g1y AM7R 9ftY 7D0g hMBU rzRU fvDw k9kH
V69Y iveU z3rj woU8 LNjG iFLR PEn2 vCez
7bWU SuXW yHED WGng VCMi u5Fj quzK lOeB
zrQd yCbY eqpA m[D] M0V8 RqLK [W]1 QJ^Q
Gw36 gC2z bD0D VBM9 GsrH HkWp 8WDf i[f]
t7He qKR7 ZjpT 1MRu seDd tSZz 19Td hnjY
R0nz OqQo jfm0 09dB g9oe Yll7 wTgp HIcs
zS6K C3P0 nVMk g461 Y2NF Q2Ad XeQt NqHh
myj1 ZSsV oiUe orSy Bjax uYB6 i8TC aCOH
UHwe FMN4 1Ic6 R6ND k01^ fBDS Ul9W ulzO
KtyU yogK mOo8 LYiO mWzR 7VOU LULa cj3f
48Sw JrKs IW4B Dd0z CkP3 vqI0 ro9B v4Yc
7HNd Vjrt 4JaM Vh7S [n]n tP4P 7YKK JML2
lWyh pntH xP73 DluV fnSz 6Q24 txs2 UmVR
4Ivf PdHu CtMy HUau aFEp LcyL 8jBc kRof
qYiY MntV GcCX ISO1 Sp9o StoY LffP kBPQ
nPV4 YNzy FKAd Ym^B WjRF arAj Ry18 jKy5
dy6M O[O] wcLj IiMq YxVO Nonv 2Ly7 o3po
38IV JhPk tYMK pl75 49qE APeB dVZ3 1dBY
nmj6 xc8q hmoM WyKu x9rN EgK4 xpJw vgZh
Al24 16qP vJPx k4ni 8AnH ty0U HmnB 4gAq
SQac kvh5 uMkO gWbY B6Oz J219 QvCZ jGBt
yfjt QXZk YFLM cexG cIb3 Aqgp jSij [Y]H
cbqb Ilsz XVlE [t]l 3IFW NJpx Y2Qh 5MZN
o9cq rIkV UM7I JljG incK 9Xvt vVHB TZMq
LCFD cA5S ool3 7wbw mGKh FDN6 HC^o dBSK
lK89 vRiS vHZ^ dob8 xpdj wi4E Dga7 rD6e
I26w 2zpp y4PK KO2h t[R] 7[H] yExQ tHEc
yISR yjZm 2uS4 f3gY S8ap 1kON wVkM d3eb
7OuX DCR^ mtPe EfF7 RE5X 2G58 XDif PvXD
Hp8U Icd6 xuwL aQcO cJk1 JS0E fR8l v8Va
RnDw 3Wef QYQd EPMS mAIp 23fs Omht [^]P
UqEn n[l] fBL1 dD3e Mi9y GYKV NkT6 XwHE
d8mY 7mE5 Trsu hsNu x3u2 bzWr lNhA FT7l
CDhM kM6g 31LA A8xO G[m] C37y Jbge i8gg
LTSD 7ZBV 6ZDu vLSG vcre psm^ BTOT ccGr
NUSu BL9i h5ny 2yEE GPb6 PHq5 [O]y SMhD
bRvk rYeW XckQ gKEW HfOm yPAz WpFw 303m
Mcw^ 2Pjn [A]m gobb
T
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f3f969 No.20302
>>20301
▶Anonymous 04/30/20 (Thu) 20:28:04 65d16b (7) No.8982995
c9CL mbFe y5sR IY5C KKOl CPUN Wzg3 7jAy
6ZQV GPwv BzHg oZQS 0m4s NFwj DjvM beVg
KHvo lSga IXdi M7Gj DSzn K0BL k7Iw BE8N
3kWD aqe2 cnfM KvpB XQnR WyH1 La3K 7lv9
qeOv GlCC M06h LPSS KIR^ 0dzU pNTd Jlgi
WcpZ GNO2 nLVf 0tMO EH7y 0r^p l0p6 EwC3
pHEP NtQf r2Bt nAeE fWwI JqRk YOIj uhEc
F2a2 lvNl 4AS5 nqMC BLTy mjXv mnfy g2nx
ekrP l9fP F9ab HjP3 J2^c plw1 oJ3T tLQO
vsCF uEBF hoRP SFmT 04DB FMz1 YY6Z LN9b
i9gD Qekl V[J] F185 CBDb r17O GEqX W8x1
qDls 5Idv gE9o gr4V XZmp nMiv dQgL bqQS
8R^9 VAMQ 3VZJ t8Fg K13^ 1rT8 xBOw Dxv4
h0cY pwmD wa6O GdZA [L]Z 2zOR xewB 390J
bjTh 6znL hoAF u9cu 5TcL EDN6 KYOB Uhsx
oItm Mfpl gpXE qsE3 HK9v f3QH Epne 30GE
lEs2 1knk eXjA xJeP cNwn FtvS ccDn QoAt
oxUr qg8F 8e4J qEfL 0GXr 3khV JzO2 m2UQ
UXmJ N3fw WVl4 kPqi SLz^ HJc1 gVzA ux7B
r6Oa MWmG bOsd R1yr eIIj rC1X 3O6^ zdtE
3jFS MgSL r[j] 4W02 wqaS BeLI AoLl hf8G
Sd7V j3JY SsG2 O8NZ X8ci gc91 0VBt qQGp
bQj9 jmxj nhf5 Il1l fbGt 90aY kVVj BfRO
BWNx hcEX gJgA rSfe wVsC rHsI kNJ5 RHdw
R9DD LtfW 4ZcX Dwg6 BYzI Ew^1 pzUG i9dJ
Tidf RB7C fe8N U8bw p3d2 4FoU xWvs 3[9]
7Bua IfG5 cYyi t8D^ iTzQ 52Gs CGpr I7SY
dCrI znWa Myy7 FyRt nt1d QwWV 8VFp VxlO
iMy3 MIWp NWig yU^i 9W8b yqVJ W6Ye 38NT
peVW uOar ZQAy lcZ1 i1jX gIn8 7Lap h1Tf
6jPN zSmf YqSk Vlr2 0iLt QLmX q6Gu CFgp
0qm3 ZERR 0MlX QVXF W3jk S8Tr 2z1y zZQs
apIT VRex wAYm OtNs 704t 207K eCDx FGzn
dMyN 9xGX eXAl P[l] gEqa Q1yv FlOz Tu7d
IIR2 KaeL hFRV x4vI kHBy UQcn WHHL U9ij
IGFn pbJ5 LeiP Ub71 PgdN T[M] Z6RI VVLm
466W hwzu G[D] YSqN w0EO 9ofW XKTh Zf2r
a[J] XV7x t7Be Uu9k g2Q^ HdXI 4k62 hck4
zhT1 0L6r ALQ3 EIUC gURh xXSD 217V SQRJ
A[x] 2btK 3YUO CSrt mpEb 2mZj wnHx jxxQ
DGuJ LEqH 0JHz awxR r3XD wUod eO5F n0kf
q6xe ixSw 5KCu hIKJ Lp1A 88Cr DPEh f[l]
2XID I2aH DIdi MI5X n[F] Ku3k XPVH BMjj
OgDI jO9I YTMH NJfM GQA0 mBnM cDQY 6zO9
dvis HawC 6N2q ZIKT ZBWw D67g n9sQ IGu6
iPOG buKu YIHG S4E5 SeXM B[l] ZmuF 05Tw
CpMX 1nVt 30G4 rZ0^ 4hJq P9iG G4JB j7Cc
oAhr 2blj smMA RG40 CjoJ 5pFS Gg5t WDxm
yOgz IVP^ Xg^N EWrW umZW IJky iEHk iwCx
X6Y5 f8jV y8uo 4HhT maAo gOgu BDgq 0BHP
ruiT NPM6 y4V4 4fp5 3hTk 03r3 jOiS lhYD
qHWD IoRz rTjw Fh7g Y8MA 57hL [p]F wPZ6
XBvC 1Sqf mF3V uuWM bTtn LFTR KbRX wHqT
1q5p SQwo 3UF2 0GGh 6bK0 G07x guQg hKj8
2MmO YWGb OcLm F[c] ziFz BuRj OGjD 8Aob
t22M gB0p QQ6F 1wms OQ53 R8z9 rhBm zxYg
PM1b p4Pp I9DR k7ve nYvE VtAw eFnv 4jF^
3adl 3kPX x9h2 nzCC HahM Lgbm 3GVC Bi29
[u]w hdF^ OY8k cQeh ZJC2 azwW Ekwq kbp7
OB4z eCHh Z7Fx UuqN KDEb 9V4H Ic5a IhLK
t1hq TJj9 0l1R rr9F f4gl y7nm olLn B6fb
3L7O ZXyv PAUK ugy7 aZxS B6bT [8]K cWJ9
Fctk a5Kr nzeV Jci^ 6I87 qVnR YiBn GwAG
ur9f crdJ G3de a0to 5ySC OVSW A0H2 TOcL
tvnw yLaI HOkQ rRBY DbSr R0cP 89Cb MpxN
HFhh Ux5X 2p^M qS2v [U]f OdOq duwo aAzC
RBFV dV4d Zvr1 GaM5 [2]B cAC4 Bf8g AnlN
kk3i Wb^W 1QBh FY6C v60z J9Ja KDyj bDKv
2DKF U75t 1DXE a3Zh 8arl 6lqS 6lmn SUKY
6VSO J6Rw oU1F Yahe c1Sx VxX5 FTjJ WLc8
rYHx iVAb Od50 I1tV UzWS ApOz JWQD 2AvA
e[k] ovqv uDqw Aa0q NlAs 2QXi fFJe ma4M
gRsF exZ6 w6Wm 4s^T A3ix [0]a XEhS LTJb
duC8 dxuX 3IKS 32YU CZMW zAeX AFBj 9Zus
vlp7 hN4b ubdj [1]K Vsh7 hqFZ 6Pmo MUzv
8LVP Afa9 eIER 0x^I BcqB Jqzi cDDx tnpW
j21L itZg Rj8K DiDN TZi7 cE9P 5AtL DVHW
mtGm wd8j WvYP CQeD vAb0 [F]X Ryfe YY6O
DjVF vqwg jlFO FeRR He^F IboR TdRj Zbxz
cms1 69UQ RBVP [T]0 wt1X w0Da X5TS VmKL
swHz pNjc BqWI 05XO hxeQ nzmB r9Cd otD^
hB16 7CAU PPx4 jzfj XfhZ gpzl Ng0X iq1C
PfqH k2GM sBMJ BcA1 bsPM PlNB euli gO8L
L89e Qg5n T[B] QwYK X464 dNMM pd5d 1kiT
U7Uf 4fwI d3f1 7wL2 fteA Wp8e rUlt fuJg
HUYq jMSV 1kSa oMqT uGgD z5DD tfj0 Pt8V
73CH g8Qf gD29 VWi4 svNH cP9x OMsR 1Ekm
iiTq Gpcn f56X Z97c LrkL NKwM ciPt zx1S
pocf QnKN F[O] TDhY 9F7V rZPf cx7j WvvY
QB12 nCAj F4wm fj8a Z5li Bs6F eCDW hHIs
Bfrg kYaJ Map2 nIS^ 1DQC RBvG STxB fUkD
rZon 0Jv8 hjUF 849E u2US Cgfm jJCG 0F6K
1ZTq rRak ub31 b0fA jkuA B5Xq FmRe xACl
Gr4X EvqP PTYh EA84 14rU Y3hw aqsp I7NS
druQ z7zu 5qpT WinA 8e6y YyxV RTS6 eaqF
YMNk 0WnS nHqS KxDX mxbw nYhU XAKR [H]0
CkAv G8xy 6xFt eCUx 0zCu O9PT 1ys8 tWbn
4j9s Qrxi xiDz jNnq Cqj2 J4LJ XQ3L PdxM
086k uRXa 5HY^ GeMk lHCa 0Dk6 xlLa tdF5
ZlwQ MOKt D53S 02Cp zgY1 [4]b 1pB3 A5Mn
oSEZ f[x] Grdf 4FS2
T
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f3f969 No.20303
>>20302
▶Anonymous 04/30/20 (Thu) 20:30:01 65d16b (7) No.8983021
8919 4730 0354 886+ -436 8280 -208 7435
7106 3735 66-3 7420 79-0 02+0 7681 9922
2900 8-48 +462 048+ 7878 6879 11-+ 9137
7+56 4244 8-46 516+ 69+8 801- 2-0+ -9–
0277 7495 4823 -+92 575- 8064 6503 060+
9+17 6325 8-64 51+6 18-5 5-73 050+ 2577
4810 4715 +0+7 +081 -07- +096 7–3 7293
5247 -891 09+4 55+- 4269 9-8- -301 75-8
9167 6889 5-68 9170 9-21 4599 37-1 +826
+3-8 9+28 974- 8477 62++ 0865 5295 93+8
621+ 9411 85-2 155- 22+7 0455 ++-7 0041
2-51 0731 -11+ 0996 344+ -558 +786 3431
829+ +520 +5+0 5+92 7426 96+- -094 97+2
46-6 44+2 335- 5517 245+ 5606 0755 8057
9-+7 0185 +-00 -+03 2393 5487 5116 2142
0-57 90+3 25+9 5909 5106 013- -5-9 9332
+91+ 347- 6-90 7457 6093 6797 3776 3822
-292 8986 0++6 2022 0493 9027 388- 5387
6-62 5481 8471 470+ 9382 15-4 8116 74+4
7124 9++6 182+ 7328 5226 80+5 7700 7576
+450 535- 70-+ 5283 +192 103- 30+4 0393
+6+4 49+5 2414 5121 -8+- 1588 9445 6981
602- 8735 3607 9297 7+98 499+ 09-3 -4++
-616 85+5 9+01 29+- 1+04 563- 7522 8012
702+ +518 +918 -82+ 6100 2861 62-5 6444
235+ 245- 6349 2726 72+6 456- -044 1+43
3040 2-08 +557 9655 181- 8044 -500 -071
605+ 5549 9104 5500 6112 7+36 1302 541+
5876 2781 1758 2811 5711 90+4 0560 6762
4+-7 5489 3226 9108 83-0 9-34 8-89 776-
5-16 9470 5334 8+-5 7455 7-39 2015 -763
2607 9991 -854 5-81 9379 9780 3385 4-02
2902 03+0 6018 1821 -388 7+-2 607- 0-33
0309 5++6 -47+ 2073 920+ +193 0+81 5-72
5827 4110 922+ 0843 2291 4-+6 93+2 7860
-0+4 014- -006 4234 +273 4417 690- -+67
2643 9227 7084 7273 9271 1401 47+6 2730
3-63 +935 66– 5-79 528- 212+ 9184 +410
-9-7 4–3 1040 769+ 5-33 946+ -532 0344
4089 9761 930- 9-0- +731 +19- +337 1922
+713 89-6 -96+ 722+ 6063 3-76 -857 0627
9341 414- 8712 -398 79+9 8358 5593 69-5
6637 0000 0361 8-07 340- 6-33 1524 1983
3628 5+-9 9953 5364 4211 6727 3043 -480
41-+ +439 3947 8746 6+62 06++ 6783 81-6
0875 2+01 -233 8551 +335 1289 4626 8+91
401- +304 0823 0233 1405 4467 7-68 279+
+89- 4380 6375 9511 9243 3861 2839 3725
+697 +693 66-5 9939 124+ +87+ 9+15 4172
01+9 0012 915- 9227 2883 90+1 +596 1+73
6046 0266 22+2 2954 888- 5-20 –46 7167
7+83 749- 3324 3843 4160 +924 137- 8125
8921 1213 -787 2084 1945 11+4 0358 2355
5461 3–4 6748 0073 3681 8208 25-0 96+6
1051 +715 0709 3561 8175 2351 659- 14+6
7003 5581 -33- 1871 1164 5159 218- 7241
8746 44+9 7978 5+-0 9143 -553 5364 6229
8729 3995 4838 9551 2-92 -781 70-+ 3+–
+414 01-8 +6-1 7334 0262 4986 6262 -150
-475 7571 9021 3246 342- 741+ 5625 +354
2286 7530 69+8 4-7- -+22 50-9 9810 16+1
766+ 8061 87+9 8193 981- 0604 5095 4575
0526 -235 2868 +18+ 68-9 7807 9458 9869
9298 5657 619+ 8140 7532 +207 5014 6185
5562 5146 5389 262+ -9+3 9927 -872 0-74
+422 2865 48-0 22-+ 70– 40-5 12-4 83+0
2+83 2223 1526 44-8 06-2 2063 -658 8926
-03+ 5904 7554 -715 6-67 4024 0295 8298
3230 1717 0142 9938 3-33 6628 3–7 6638
9031 –6- 5165 9165 +653 0-2+ 6096 0375
5-05 7884 6643 70-6 +412 2463 0873 0821
2730 8070 ++4- 7405 9637 156+ 5347 3662
+434 4068 +080 4-56 4620 93-4 691- 2+59
8308 7809 2-99 8092 1910 74-0 9016 +406
-203 2368 43+7 7+88 3-3- 7247 -2-5 9245
6390 638+ 7634 3963 7890 +-24 573+ 97-1
5–0 2442 5512 914+ 9+73 5293 1925 2489
1221 3201 33-8 2+-8 6663 +21+ 60-7 2901
-0++ 4252 0477 5613 +464 966- -742 2809
-1+6 -898 35+7 4783 173+ 5584 2+04 2-0-
8+72 8089 2979 3751 50+3 5875 3472 5517
70-1 3-+2 3159 9+60 12-8 4470 3-+5 3-00
620+ 57+2 -797 +335 0+28 +994 2932 6+51
6+70 1-34 7551 +290 513- 8+55 +714 0–3
2408 57-9 -496 119- 2–+ +767 0578 83-7
-368 7++- 2637 7-48 29-8 5998 90+8 0337
1-14 -5+8 3744 12-4 587- 8260 6+59 2528
1114 7+25 -048 5-13 -+45 2119 1+05 –53
3834 +7-2 7+83 7+-4 2898 0262 5098 06+6
8-27 5610 8-93 1402 1222 0387 4-48 0+61
47-0 +493 +012 3-75 7678 8-68 5224 92+-
3549 03-6 14+0 5052 1833 51-3 7045 87-5
77+- 7794 +564 1682 4271 8953 3646 -48-
0-46 4+32 7635 6640 4457 5856 -+66 0880
3482 46-9 6787 5-75 2577 9972 1957 8260
74+4 34+2 -982 +330 4-2+ 7515 ++02 98-1
75++ 7+9- 80+5 -47- 4905 0084 6280 7910
8195 9+75 -848 80– –3+ +336 0278 9063
7117 19+3 9982 9430 0920 7+31 7979 0922
–+6 9+37 9575 -815 1529 6251 68+4 81+4
08++ 5428 19++ 79+5
T
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f3f969 No.20304
>>20303
▶Anonymous 04/30/20 (Thu) 20:33:08 65d16b (7) No.8983095
bG9U od8x WsYV Lo2Q jgXi f33f ZAAH xZVA
pYIB eVDw cTco zdkn kLe4 gpzJ ZIUJ 84Yp
fJ9o RMpv 5tYh NyNB N1a9 qSws lAjM 6zhg
A43z 7BV9 BTtJ kxMf PgbU 6YlP 4tj^ 4IDi
gHjc smFb VdIc ioOi I3M^ mbVq gCqO eSvG
fYNE NaUP w02i ENlX NH60 4B^0 A1At kGwZ
CzW3 9dPH y0Ls uDiO dyKO WE3^ WfwO QHwa
ftaw 8SIU [t]^ cfhV p3qz fNXt 48Pr rCiD
UmP0 xfw8 aRt0 1RWN EWrP rSOV GWwI 44eV
gPbJ t2Fi klGP PvO^ cnPT IXXi R0rF BpRe
32Vf ajOQ IWsj NUmB Cfap 1IDk csD0 Dmz3
5[n] wQl4 uu7P 6Prt cBHT o7jU W2ug 36eS
[F]D oWFE 1sxY lmHJ 77qX X10l IG^M IdIU
DoRQ qTnv JvoX YlCc SNYQ lvwe 4iLU ewzD
i1P7 2O2L NLyo Aulk zLsv gZNA Pswr J0Ee
vKVd oCE9 ErSx rbdZ VrxB 8AXY rogm rKg3
EVc8 3cWv naod oESP xhEY Oz2h 7xHv kR87
CBbA OS^R gSfV A4i8 rYwD 6W7f 7k2i dmKj
[D]z 2vFA BD7B gvX9 lOuA yfYv IpQE L83Z
gfiC gV1H fWGR FBCp RdBD VGch f8lR aq15
sOZX rq4O q4JX T0Dn agWJ gntb kTjl GvTg
oCJO TP4o Vwn4 0N4U va^j uQt0 MR2i qqhs
7EJI MHCX EZRw 1HUh ij1p 8zEN avIo sFD4
hYG2 sOEf Jb4e poTA fvGr xYbC h9Ur 4xl3
3zxP JZx9 f[k] 8nn8 1EMi 3ShR 4Uw3 BVJ4
i[Z] 3JeL WuEg LVwS YYuo Nytn w8Rz aIab
2sMT V[w] mFYr iYzp pHRY bue3 uyte KzfR
AZtc 8oxv ZK3X HS3p gT4U FRzC AU5i 9Fjr
3fHq uFx4 g6sl 1zwN vUTg kect enmk K57U
3O0w fQFr dp08 M0B9 AQgX JNiD PtSk FncP
GOJ6 JKfG HjJb c0c9 tEou 4x99 xWGU ORWT
4EP2 tOc8 vxJC [W]5 6LAx yFPk kdEw 1Fo6
A9v6 U9jU T5KX amF^ jUto 0xq4 eY4E tILa
S32T [y]k ICJz uiNK UFyC OcTp TEoO gCVH
r4S^ SXOc IeNY DJfG rOei Wqpb [P]^ 4Viq
t5Vo gES6 nHan z98f ui9I qmhI ugMz fgYw
lMhr [^]C mrMH tURk EaAg J8Ps aLs7 yMor
hGAj S8mo QeNc HXcu owWF Rq9G K17Q fM5j
5H1q ozBv iuvV HWuD m1e^ FKmO PpqZ [d]M
OZMM jtzM CNQc OYxp 9Rik Dx4x RSf5 cNbi
J4ba 8Agw 2xzS X1YD lCyQ ywHn EsNq Ewlr
6nvE BxHv QaCv Fabc YfPw 1eFw 1s4L SRm^
BWeK GUAP rUZ2 2urJ BeQ2 yhDa pOUN slA4
y8GQ vMZv 1DrE Kw5N DgFz [A]d 95lq oaFv
3mRR Hx7G XxJf 9A7p QzXa AwDX A7P9 n4Cp
QWti [6]Y U3h7 KBNm ft80 P25A bzXq lfWv
OwaJ Qbbx zL90 sEcr SrLA kvD7 cwra gfVO
FhGx Vt1r [B]S JfgQ Inzi A0AS geVy ZOCk
4Ywq WihB 8h0w EZzc 3uEn LuV6 mjS3 4Qub
mQ^2 E0gu lhxT t6nP 60Kn 8Eax vgVz h4OZ
Bo73 [b]k uFD6 JCmP mCjj JpfA EkbC x0Mj
fFRl v7Me B0oN DhqC WalP h2Ss WuLZ D7j^
ZBPh TkZA yK4u VYnJ AH^Z 0zWd EaWE AUGS
VYTB BvjD KpYa RXUo Al^k n8tx vZb6 P4Ez
9pCu LPq0 II0D MQuF A2Eq S4Co GUB0 gp5Z
oWe9 DJTx HPGi yqWk JLbs Baz3 nHLH wX5j
YykY nhqn laTG 7MO2 k3FP 7OjA hBVE DaiW
4KEn xLDM pLxI za7w 8m4s V49X yGO3 jazv
9MKc QluL rg2X rwVs ch3r bPV3 nDUy p3YQ
Q2yP dBg^ lBGk KS5j jsJf YNN6 9uw^ Mp8e
PFRq i2VE yHAQ ZsiW VJQC 8Fmq T9ly F234
crPh rDeg eNTf uKao T5U6 n7kX b3nS yABo
O46z 91Wu 7jGx Term eKOI A3r3 Fvdb V68Z
5oTO C2PI aRNK scSa SXKT DGNT c2KA VNNT
eEC^ h92S Voau OJG7 0QyP 90v6 2bi0 MCp1
SwXu Sn9v ed^G z0ck gHsT 8P9D MuR2 hBjZ
oMgp y1DF HOdw qmzI XC4^ 72vc Y[P] SJkQ
EINV QdSj uq5J qCYY hf42 MefP Xrq4 tPyG
uP8A Ghqv azFR THPU yPU2 8TZ5 x8^z LQWC
8n9h b[E] Daut 18V9 lTt9 zZsl m1du QOA1
XwIU mbXg KPkT 2iHj Pkg1 eT7n vKFE OH3X
Qc9E LAlK yGis IFcz S2a3 ryCL 3Inr nFSw
pP4u 8Ba0 YA9v bO1r ldvs qdvb fFUc ItFB
mY63 EBHT 3c9W y98l v4xi 3LNj 37Nw Qtwc
rLL3 ksSU FJe9 VU9F Fu4V mppy vzdC 1dlN
Lv5T NLEX cjbS 7IW4 lrxu kE00 KfQ4 Vxr^
vyaE Qz^6 a54a 8MZg cXSo ixJv E2Nv Rrt7
NjKh quWJ MWEP uWg3 Pg2j v9U^ W9to jokF
FvRw 9b3F dhOK pO2I 4iil SsjV kO^1 Jacj
xSn0 Zez5 0d9G ZN2O qLjf 4XA0 LDYX ClcO
n4DK 6flm s4KZ 0tm^ m8vU CMMD CdYb XjfN
8N73 cm^7 tBVK bG3f e10g wz7I 7Wrp pfoK
D0LI h4vS 1IsV fh1W p[E] v35j sow5 q0kW
ncNK eBEd p5C3 iXOu S4eI 3lPI QELp [E]h
7Jqh FIWJ qBik j4Ih [1]q n[b] WTde EDpk
yuWY E1su c33t BCvg UBkM wBSq 2Cbp 5J3d
qkGz anNC 4Gl^ VfCJ Z66q jWS7 aPD9 fkdv
9tpb zbAX bNUW jeB2 Fptw Q8Zb DAEP Zj7I
qA7R O2AM 5Tpy Ycr1 7r^M UQPr clnI qq^Y
9DOn z4Ta O5^1 KhDM bwt6 kHsR XF3X 1esG
ayuz dSGH E7sN 9f7r nZDy cmgA 2FDb NILr
7IFG TVeA QZNm XGrx Ci^D MyzR u6mE EjRB
sd9T AENe Ppuh LIgE KepS ybbf ASfz NfVA
NPA^ ohIG hgCP iBze XRUv bXi9 j9k6 aeRq
z7ZB rPcY C71I Sa4W OCJj PfLw 6lZb wLHh
bwU9 x3cE sKOu JV8n q3rz gmPP 80b5 mr2l
UOsP GkT7 Vpzn vBnR TMfR xXkn Sdf8 Ldwu
5ON2 qYNY uRh8 wC90 dHf3 0kv6 O5Nc Ghq5
Jrsu 74Bo oqvr eMyB uFBl qCAi Pvel NJ^R
zLaF AtKB QwU9 5flF 5oHn nagJ Jm2l Dphj
fMPT 7U2G ILVe mrSB
T
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f3f969 No.20305
>>20304
▶Anonymous 04/30/20 (Thu) 20:33:53 36cd5a (6) No.8983108
[Re_drop] 2x
Only Frens will ever know.
(You) are doing this.
Anons. Now thatQput you 1 day ahead in the News Cycle. What can you do with it?
You Have the 4am.
You have caught 4am. It is forced to change.
Be ready for New Narrative.
What NOW.
You are the NEWS.
Write Now.
Right Now!!
(((They))) Are in PANIC MODE!
💀P💀A💀I💀N💀<3💀I💀S💀<3💀C💀O💀M💀I💀N💀G💀
Producers, Are You Ready?
WWG1WGA World Wide
WRWY.
We are Watching.
We are Waiting.
We are participating with (You)
Together WE WIN!!
o7
>>8982973 lb
>>8982989 lb
07
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e326e5 No.20306
>>20305
▶Anonymous 04/30/20 (Thu) 20:41:39 65d16b (7) No.8983248>>8983402
[no] [nt] [ra] [ns] [it] [iv] [e_] [__]
4373 +443 3638 4391 5308 8305 9-08 926+
58-1 9402 86+- 3572 5761 -2+2 4566 +400
9370 2383 6179 96-3 27+0 94-3 8513 9+15
+3-7 0-+2 7872 2617 –6+ 3794 4610 93+0
9-89 6487 04-0 1157 5920 3+28 3588 0+55
0463 63-4 4666 -1+9 1706 3246 4764 3165
1+13 9952 0615 9+-7 1479 3098 9015 032-
97-8 4627 7758 4755 5860 295- -21+ 4561
3421 3489 348+ 502- 0720 -85- -033 7+36
+343 6447 -379 6875 6904 7765 85++ 7488
5146 4864 +337 0076 -686 0+40 3038 0552
++12 7085 +156 427- 438+ 58+8 0-54 108+
0630 +-1- 659- 3261 94-7 8+69 730+ 3375
6723 7071 2337 5235 -9+5 6141 8248 57-7
60+2 153- 76+6 +752 -8+6 +4– 4426 429-
2+-9 7-06 3145 +360 2031 3045 6235 4-02
4+75 0186 220+ -47+ 6-86 6413 1717 9++9
3857 3+53 97-8 -+24 0-18 9268 4-74 0175
5005 -265 9732 9920 7+89 7273 9008 0147
648- +863 864- 90+0 +617 19-0 6-42 1761
5581 6533 3940 8–2 7534 +333 10– 998-
+257 1528 3448 169- +3+5 9545 9-+3 -+84
+7+0 2147 84-+ 4834 086- 7858 138+ 20+-
9599 2079 5967 1931 0324 ++54 2+74 3395
-7-9 0004 7379 5993 8164 1-5- 3646 6316
+492 4315 5678 7469 59-8 971- -794 2-4-
2303 547+ 74-6 1915 50+3 -40+ 6649 4489
5-8+ 5820 3718 6357 2+07 +839 0+25 11++
4171 0++5 5798 4193 373+ 5412 1487 8831
8++7 3516 9-76 41+5 7373 4011 7403 9499
2–1 +0– +-23 3+85 2160 37-5 +688 +806
4916 8389 0+75 9275 98+6 1947 7544 0930
7424 4+30 08+7 00-+ 9+18 147- -945 19-1
7273 22-1 3759 2433 1644 3962 4-08 9739
796- 1749 49-7 8666 +91- 8-90 -71+ 8765
08+6 4816 83-2 3002 -601 0938 0478 9411
80+9 -+63 8011 9908 1-37 1-+1 7800 8368
6538 57-+ 5954 7821 0943 658+ 4611 5217
2320 7279 5065 9+92 98+0 0360 +777 39+0
9824 +58- 6-7+ 8398 464+ 3++- 8982 7-+3
6496 7815 7472 135- 58-2 1688 7+19 6141
6760 3+59 3-50 2+38 7655 -955 1-+8 5474
-774 0752 1876 7258 3287 834+ 60-2 802+
81++ 4218 9671 417+ +770 8+29 3762 854+
-327 60-5 -684 98+9 83-+ 3920 3087 1330
5-+7 6320 4789 24-+ 313- 38+6 7070 -846
1099 -152 4+12 8069 5-64 3307 +29+ 6191
4+53 4472 45-5 5194 0362 9-8+ 5841 7638
0663 58+4 87+9 88-8 73-6 5-57 06+6 2824
1682 2785 +711 11+6 9711 979- 816- 2+63
-517 83+9 1320 576- 947+ 1734 1832 3-+9
5884 -65+ 2102 6+6+ +193 0973 41-4 +32-
34-2 9338 3054 3150 1579 1812 -6-0 3+71
573- 677+ +045 9537 676+ 0942 38-4 -4+4
7+70 999+ -+74 5+86 7408 1+40 4484 9+08
+736 26+2 799- 3150 9234 5174 7111 64+3
99-2 2733 1+7+ 7145 871+ 1898 394+ 04-3
4058 44-6 44+- 96+6 9939 0748 2797 78+8
2684 -700 -1-4 +159 9174 6524 9-57 +715
+996 1736 -435 -1-+ 0012 9+16 2257 9975
9056 5-62 2079 2789 33-3 4032 +6+9 603+
3+9+ 74+5 +906 9370 9810 -89- 38+5 -496
0104 2741 20+9 20-8 4405 -090 +357 9698
3+01 73+1 5986 +010 26-4 3-19 53-4 5780
90+0 3181 3148 1236 7-7- -3+8 233- 562-
6-85 6883 3935 53+5 9872 5775 0133 9-45
630+ 5017 4828 5197 1554 88-6 6735 13+6
76-7 4761 3458 7+50 +463 4+72 8609 9822
6-84 +855 6142 -33- 9849 6-07 2644 30-5
5116 8894 7981 -085 +007 20+3 0920 825-
5660 +139 5970 -732 844+ 8000 -679 4961
+103 9199 81-+ 0051 +839 4426 20+4 2070
8877 572+ 753+ +4-0 5+56 89+- 5989 3502
0215 7372 5347 37-8 2+44 5423 3+64 38+5
7895 298- 7188 8-3- 3+56 5+07 +432 2321
-+38 3519 3186 4393 6-2+ 50-9 7282 6183
765- 8675 3143 1+75 +-39 0031 4+93 2-4+
6838 5915 -477 7+03 467- 5409 70+6 7350
-4+3 6251 8373 3-+4 -841 -886 -226 8595
5250 3234 2596 1005 7740 3-32 620+ -128
465- 72+3 4+1+ 4+2- 4094 2769 -+06 5+-5
2228 8184 7490 57-3 7-12 +477 3546 915+
56+4 5643 7816 7195 69+5 4073 0+85 -89-
9335 1585 1617 +714 5335 885- -472 827+
8451 2868 148+ 8496 +1-5 -12+ 6480 70-5
2380 7475 0307 115+ 7221 58+2 7918 712+
4+91 605+ 4+30 6569 930- +544 7694 2787
3789 1625 3288 3668 1228 04+0 5+8+ 7-78
-264 8336 0570 662+ 3+26 1079 0335 9040
2774 1+97 9168 6771 -1-1 2230 833+ 1181
-272 1+3- 154+ 33-1 8+– -995 4959 5400
6865 977+ 2607 0102 9-60 0-64 0468 +536
7906 211- -1+7 3591 5239 1+11 0577 0318
62-4 922- -913 4678 7192 9+07 2822 5195
3315 -47+ 5306 -445 3095 1159 8780 29+6
9981 60+5 3093 5809 7057 -+18 +9+4 9335
-384 1255 8+-4 7215 7–8 581- 4152 5792
+653 299+ 5602 +246 +608 5+5- +69+ 293-
3570 6562 7-01 18-5 7269 408- 6318 7-4-
3937 3952 47+6 1924 7006 -19- 3855 1611
0862 6752 8+26 492+
T
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
42bd10 No.20307
>>20306
Is this not T saying Q is about to post?
>>20306
▶Anonymous 04/30/20 (Thu) 20:59:47 65d16b (7) No.8983495
qrn
T
Q !!Hs1Jq13jV6 04/30/20 (Thu) 21:00:02 a1a33b (1) No.8983501>>8983511 >>8983515 >>8983517 >>8983518 >>8983519 >>8983522 >>8983531 >>8983532 >>8983536 >>8983537 >>8983538 >>8983540 >>8983544 >>8983548 >>8983549 >>8983550 >>8983552 >>8983554 >>8983558 >>8983559 >>8983560 >>8983565 >>8983566 >>8983568 >>8983572 >>8983575 >>8983580 >>8983584 >>8983586 >>8983587 >>8983588 >>8983589 >>8983590 >>8983591 >>8983594 >>8983599 >>8983609 >>8983611 >>8983612 >>8983614 >>8983615 >>8983623 >>8983625 >>8983628 >>8983637 >>8983646 >>8983648 >>8983650 >>8983656 >>8983661 >>8983662 >>8983667 >>8983669 >>8983675 >>8983678 >>8983681 >>8983686 >>8983688 >>8983691 >>8983697 >>8983705 >>8983711 >>8983713 >>8983714 >>8983739 >>8983743
https://www.youtube.com/watch?v=wrZejBRSAO8
https://www.bands.army.mil/music/buglecalls/tothecolor.asp
Q
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
42bd10 No.20308
>>20307
This means
T
Knew
Q would post.
And got his in
.15 seconds before the drop?
🤔
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3340d9 No.20309
>>20308
>>20308
Anonymous 04/30/20 (Thu) 19:56:03 856d30 (14) No.8982323
GhLX zhq2 UdMr DkCL nHAI Hkh4 6Bih eZua
wTUD Yk1H Smre kxpV 0fg8 7fk8 HWhx WiEg
E3v4 H8Au ykWw gM32 tEPF IUgu ZXY8 lgWM
2zot BqV3 JbQW qpfh plPb 1qpB s2Dv sghx
[P]x 8T8Y h5c8 kfNq M3dW TIs9 iwkz pXqq
3[U] sa40 [9]c u1NF Bytv Ktnv qs8y bmL^
cCsn 9z5o 6RlU iYDg idQv KY1J CXtK CMGc
Kmev b3gT 8wTb 8nRw GQjn ULDZ tHVN Xyfs
d2GN [U]Z 8GNf SCg8 XsKE 9pof fIpR FzZd
NL^q 27K8 Ky9A GCjc BxnO IC8n hOt1 8Emq
vqJE B4ko sFJU QmrT tl1V uCHQ TWT1 CYq9
[E]G [L]4 Zid^ GURi a1J3 bdz5 sfQq R[w]
DT0l j1T9 KKJj FdWA IsrD UiLb CSOd 8SEu
srHW YXBv nd0o U[k] HqP1 80qV c[N] uFj0
h8Sx vNgb 314n Sdzy 86Uc 30X5 5vtg DXX1
u6t0 041G Ujh5 rqrp UvLa K0aG fr6l B0pa
[E]Y 1Ki8 Ac4Q NGGq Ae75 QbhS 08iC 3tG^
Gazp LIeD yTzX Bfcl VlXE ikZl 8InX r8Vb
Axkp LZ4b hAkK xh2M irBs 3j3Y EGS1 stPy
ch0r n2I^ ynUu Rdip A7mj kpTb YtbG TAXF
pI2k o8CG 7TF^ WZ4m UCAN xlqi GN7g tUCG
avPy CgrY 9RmR J3o^ OxPX 69Lk eXVQ 4WEU
b2Kg [A]o Vo5Y tccz jHvZ UCxv QcIY RfJd
VCYq lKHz X7bz 9RWU Qw1Q VWRC NZCJ xqA^
Ul38 Dq32 jgRJ AO1K hY^N KyUi XGwY npUt
4i5g NsH8 gd7n THYO 7mSg mzGG WJuE 0CUG
g8AA YS^^ QEAx 9psc Bx47 mGNr AoGv LNlz
qusK k807 PPjn WwpT eURt HmD2 pdqd RBWG
tliM 0W1N AKbf cNTu RlLj Ym^N lfHc cXlH
EmR8 3tRm 4JRv 6Mvy kNf5 6nl9 f9xs kFP7
FzpN 6xXG P4wO l285 fHvl FqdZ OH7E 9vo2
xf3p OAOk 3q8W uHM6 Ga0y 0EEp jmFF wTtB
vDTT lVni IqrS QpFA IJ0o ZEXb s68^ rDQF
dqS4 WPZI oc3D Sx0j pL8Z DPgI MRQQ G7Zh
3joR ypi4 ePZY qJpF CKL0 Jcnq MKRP Oj4h
ABNG SONv c0vZ bQi2 Lmwj Py45 kXhu uTXZ
IhCX fKmi PnHM pqQv 0nhD PPMf n7ok gKrL
y8CU 3SLN EGFI HiEr q9UN Famt oI0w qoER
LmSX hMuA oOgy zN6D 80OR rVy8 [n]^ eB0X
CxMq YaZj 6LfF kb3l U7ns PGld q7YY 8Uhc
QaCM FVUM maJQ 6wLE j1sM vDXU 9IUO AhO5
2aYR 1lUQ jkRH iVGu 7KdN Clyp YK2h CuV0
h6u5 nbqq PBcE SWMa TCGd sGRF GTYj cvnn
p5De m7KX Eo44 BbLL QtnN 4CvK fAqm Xk^C
pYrz Wehc pqTD 2aDZ 8y3p ZFUo DeiJ vUYW
YcKa PhWz [T]9 zndF PFZQ 7epp EpqQ FpJc
HoaH dFr9 ispa n[r] Oo0O IG5Y pjgm fsRa
CRMv nK3m h9wy K5VY DBJb VwCC e9Cl 0KRz
yrWZ 70Mc lHi5 fjNW xips bBZE 9prg EWXO
13Kz Z[n] 5GdU uwsM DQYk brh0 hueH SACv
zvoP jf78 DSvF wTWu Stse LSVo zNJA ySIz
qKQI V2fg N37w 3CbG e5gh vEPO GuUn n7DG
wGEL ziUi np1B tOX6 reMu KuK0 h7Du xglA
miYo 1EG^ SXEm Ptmq YVeC dj7G bagy i[k]
LaWw LO2P utaU 2jcu Xbk9 ef3n cnD6 blBG
cG8M LHh1 LblI YBgJ Irn0 8Qpo KOO8 bkBu
lbVC KLyJ U2Wi j9B^ WKpL BaN^ 4qlb chNN
HErl Aktb Ghnl Bidq 92w^ b5A8 Tq9b ZWwS
V33N R519 LyLy MjV6 GBWG qJh^ buV5 RzHS
xF55 ppih TDPZ MFvu MbqM AoDb n1g2 PWAc
2DQ9 5Okb ldx4 WHrT bvAn LY7i r5Hv POml
1hFP 0qgP Phip HiZu cBxG Mqnx gRO9 Dkoi
bwGT oe39 4UeE nnU^ LvC^ 7u8u 2zzX SmbJ
kXFH W9YH 4f^u Q7jw 5E1E IVVj Sdw4 xwlz
HPOF OYTT qIjM qjIP CljO [u]G yjLW gAI9
kx9z e[U] SU5N YqnY mjAU JElD L0vy mLaE
0pj3 CAYf pkxw 5VLU dVAz lQiv 8oBo Q6ee
3GdK SSoO GOGG tBqw BQu8 9Wzg RKD9 suIW
kLmg 59Ic mJkv Xo3v Os^A S3ZB cPcC psXr
h7E5 afpV y97K [p]F dAeF jYjK sVCJ 1cdn
P10s zA^l 3bhI TVXd NhJx DZe0 PKFD oocR
1[C] Zj33 Cs9Q 3bvl sziU ZVQP zp7Q 4GT4
vSdn 6s2b Ze3J Xg6^ Wtac eC2F ZAuw gcew
zoBt Y8Cf wx3U UKOx JMME FrkQ TqRV ac2T
DG8Q u5Ay MyMV NR3C lfI4 4E3W tvhi x66e
sd7q xzMm nTqP rRzS 2X7T Wx^4 hfkl P9zO
5EIg MgUI 1DVd zKnq vxw^ GRlC OLKK 1kuo
1Oqy GaAl 8[L] DqMM Styb tiDg ZtDU YNRr
wokI [V]J l[Q] Y[w] Ry26 u5L6 9IOz IV4D
wP0h YYdf xG5X D3O^ 51Bo qiiN BBmn c[O]
mC3Z Dqzy XnJw eoYe lT6M oY6p spQF gwIe
cav3 x7pg 9njA eyN^ fwBZ FFyZ qrrF [U]P
cenu ip5Y ByJ0 VGVv TMow DuAH o8^k lbOJ
KF1W ndZ6 GaGk nizT yXMj Eff2 43hR m3d6
Mwsv K[D] 6uQy 0Ios G0Kp zWE9 j6MF OJbd
gdLg LqRr KH2S 3u2B bTsj ZtH^ zI55 h8LN
uqRT 2E8i wHsp ZWSY VN^F h0T^ bxyZ jn8B
azqZ rS^u 4KFu T9w4 SzAy 2qGg omlj QleK
bV6b RrSt nBeL VZqF NXVc UM3w FqYs 33J0
7Ysj LOI4 MfP3 rCtP C1mg Cxzn Muju eXcc
K4kx i6b2 XrQF pvyw bRtV kHTa IMDf [k]h
8ETk 11kS LojJ SbNq Q3XK xI0F dqVF Y0mL
2Eg3 HcBI Z0CV KLDE jNTQ qrId 2v8r N0ra
8MpM 2s7n Pq5^ xjpd IjuA yx56 DmVQ PLJl
Agqm V7HC uBIT 1IvV g5tI tlO^ 1COI yChz
3rUk kzAr 64vt NXrQ TCGo 1wTN [^]5 1Qw6
92h5 KxPL lezy RyJj [h]L lvRp WAxC wJGq
izQl 3a74 Zjzb cFLd Kcfz csYK hGSo YB6Z
HJZ3 4OjY JDPE 16eW MWNn e95x imLj bPhF
vU7d rA97 N4GY 247y H[s] oZoy LiAk F81Z
t6oy DUFs Wk7f CObs
T
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b488ce No.20311
>>20310
▶Anonymous 04/30/20 (Thu) 20:28:04 65d16b (7) No.8982995
c9CL mbFe y5sR IY5C KKOl CPUN Wzg3 7jAy
6ZQV GPwv BzHg oZQS 0m4s NFwj DjvM beVg
KHvo lSga IXdi M7Gj DSzn K0BL k7Iw BE8N
3kWD aqe2 cnfM KvpB XQnR WyH1 La3K 7lv9
qeOv GlCC M06h LPSS KIR^ 0dzU pNTd Jlgi
WcpZ GNO2 nLVf 0tMO EH7y 0r^p l0p6 EwC3
pHEP NtQf r2Bt nAeE fWwI JqRk YOIj uhEc
F2a2 lvNl 4AS5 nqMC BLTy mjXv mnfy g2nx
ekrP l9fP F9ab HjP3 J2^c plw1 oJ3T tLQO
vsCF uEBF hoRP SFmT 04DB FMz1 YY6Z LN9b
i9gD Qekl V[J] F185 CBDb r17O GEqX W8x1
qDls 5Idv gE9o gr4V XZmp nMiv dQgL bqQS
8R^9 VAMQ 3VZJ t8Fg K13^ 1rT8 xBOw Dxv4
h0cY pwmD wa6O GdZA [L]Z 2zOR xewB 390J
bjTh 6znL hoAF u9cu 5TcL EDN6 KYOB Uhsx
oItm Mfpl gpXE qsE3 HK9v f3QH Epne 30GE
lEs2 1knk eXjA xJeP cNwn FtvS ccDn QoAt
oxUr qg8F 8e4J qEfL 0GXr 3khV JzO2 m2UQ
UXmJ N3fw WVl4 kPqi SLz^ HJc1 gVzA ux7B
r6Oa MWmG bOsd R1yr eIIj rC1X 3O6^ zdtE
3jFS MgSL r[j] 4W02 wqaS BeLI AoLl hf8G
Sd7V j3JY SsG2 O8NZ X8ci gc91 0VBt qQGp
bQj9 jmxj nhf5 Il1l fbGt 90aY kVVj BfRO
BWNx hcEX gJgA rSfe wVsC rHsI kNJ5 RHdw
R9DD LtfW 4ZcX Dwg6 BYzI Ew^1 pzUG i9dJ
Tidf RB7C fe8N U8bw p3d2 4FoU xWvs 3[9]
7Bua IfG5 cYyi t8D^ iTzQ 52Gs CGpr I7SY
dCrI znWa Myy7 FyRt nt1d QwWV 8VFp VxlO
iMy3 MIWp NWig yU^i 9W8b yqVJ W6Ye 38NT
peVW uOar ZQAy lcZ1 i1jX gIn8 7Lap h1Tf
6jPN zSmf YqSk Vlr2 0iLt QLmX q6Gu CFgp
0qm3 ZERR 0MlX QVXF W3jk S8Tr 2z1y zZQs
apIT VRex wAYm OtNs 704t 207K eCDx FGzn
dMyN 9xGX eXAl P[l] gEqa Q1yv FlOz Tu7d
IIR2 KaeL hFRV x4vI kHBy UQcn WHHL U9ij
IGFn pbJ5 LeiP Ub71 PgdN T[M] Z6RI VVLm
466W hwzu G[D] YSqN w0EO 9ofW XKTh Zf2r
a[J] XV7x t7Be Uu9k g2Q^ HdXI 4k62 hck4
zhT1 0L6r ALQ3 EIUC gURh xXSD 217V SQRJ
A[x] 2btK 3YUO CSrt mpEb 2mZj wnHx jxxQ
DGuJ LEqH 0JHz awxR r3XD wUod eO5F n0kf
q6xe ixSw 5KCu hIKJ Lp1A 88Cr DPEh f[l]
2XID I2aH DIdi MI5X n[F] Ku3k XPVH BMjj
OgDI jO9I YTMH NJfM GQA0 mBnM cDQY 6zO9
dvis HawC 6N2q ZIKT ZBWw D67g n9sQ IGu6
iPOG buKu YIHG S4E5 SeXM B[l] ZmuF 05Tw
CpMX 1nVt 30G4 rZ0^ 4hJq P9iG G4JB j7Cc
oAhr 2blj smMA RG40 CjoJ 5pFS Gg5t WDxm
yOgz IVP^ Xg^N EWrW umZW IJky iEHk iwCx
X6Y5 f8jV y8uo 4HhT maAo gOgu BDgq 0BHP
ruiT NPM6 y4V4 4fp5 3hTk 03r3 jOiS lhYD
qHWD IoRz rTjw Fh7g Y8MA 57hL [p]F wPZ6
XBvC 1Sqf mF3V uuWM bTtn LFTR KbRX wHqT
1q5p SQwo 3UF2 0GGh 6bK0 G07x guQg hKj8
2MmO YWGb OcLm F[c] ziFz BuRj OGjD 8Aob
t22M gB0p QQ6F 1wms OQ53 R8z9 rhBm zxYg
PM1b p4Pp I9DR k7ve nYvE VtAw eFnv 4jF^
3adl 3kPX x9h2 nzCC HahM Lgbm 3GVC Bi29
[u]w hdF^ OY8k cQeh ZJC2 azwW Ekwq kbp7
OB4z eCHh Z7Fx UuqN KDEb 9V4H Ic5a IhLK
t1hq TJj9 0l1R rr9F f4gl y7nm olLn B6fb
3L7O ZXyv PAUK ugy7 aZxS B6bT [8]K cWJ9
Fctk a5Kr nzeV Jci^ 6I87 qVnR YiBn GwAG
ur9f crdJ G3de a0to 5ySC OVSW A0H2 TOcL
tvnw yLaI HOkQ rRBY DbSr R0cP 89Cb MpxN
HFhh Ux5X 2p^M qS2v [U]f OdOq duwo aAzC
RBFV dV4d Zvr1 GaM5 [2]B cAC4 Bf8g AnlN
kk3i Wb^W 1QBh FY6C v60z J9Ja KDyj bDKv
2DKF U75t 1DXE a3Zh 8arl 6lqS 6lmn SUKY
6VSO J6Rw oU1F Yahe c1Sx VxX5 FTjJ WLc8
rYHx iVAb Od50 I1tV UzWS ApOz JWQD 2AvA
e[k] ovqv uDqw Aa0q NlAs 2QXi fFJe ma4M
gRsF exZ6 w6Wm 4s^T A3ix [0]a XEhS LTJb
duC8 dxuX 3IKS 32YU CZMW zAeX AFBj 9Zus
vlp7 hN4b ubdj [1]K Vsh7 hqFZ 6Pmo MUzv
8LVP Afa9 eIER 0x^I BcqB Jqzi cDDx tnpW
j21L itZg Rj8K DiDN TZi7 cE9P 5AtL DVHW
mtGm wd8j WvYP CQeD vAb0 [F]X Ryfe YY6O
DjVF vqwg jlFO FeRR He^F IboR TdRj Zbxz
cms1 69UQ RBVP [T]0 wt1X w0Da X5TS VmKL
swHz pNjc BqWI 05XO hxeQ nzmB r9Cd otD^
hB16 7CAU PPx4 jzfj XfhZ gpzl Ng0X iq1C
PfqH k2GM sBMJ BcA1 bsPM PlNB euli gO8L
L89e Qg5n T[B] QwYK X464 dNMM pd5d 1kiT
U7Uf 4fwI d3f1 7wL2 fteA Wp8e rUlt fuJg
HUYq jMSV 1kSa oMqT uGgD z5DD tfj0 Pt8V
73CH g8Qf gD29 VWi4 svNH cP9x OMsR 1Ekm
iiTq Gpcn f56X Z97c LrkL NKwM ciPt zx1S
pocf QnKN F[O] TDhY 9F7V rZPf cx7j WvvY
QB12 nCAj F4wm fj8a Z5li Bs6F eCDW hHIs
Bfrg kYaJ Map2 nIS^ 1DQC RBvG STxB fUkD
rZon 0Jv8 hjUF 849E u2US Cgfm jJCG 0F6K
1ZTq rRak ub31 b0fA jkuA B5Xq FmRe xACl
Gr4X EvqP PTYh EA84 14rU Y3hw aqsp I7NS
druQ z7zu 5qpT WinA 8e6y YyxV RTS6 eaqF
YMNk 0WnS nHqS KxDX mxbw nYhU XAKR [H]0
CkAv G8xy 6xFt eCUx 0zCu O9PT 1ys8 tWbn
4j9s Qrxi xiDz jNnq Cqj2 J4LJ XQ3L PdxM
086k uRXa 5HY^ GeMk lHCa 0Dk6 xlLa tdF5
ZlwQ MOKt D53S 02Cp zgY1 [4]b 1pB3 A5Mn
oSEZ f[x] Grdf 4FS2
T
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
aa169c No.20312
How long do you think it will take
👻
To crack T’s code?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3340d9 No.20314
>>20312
⏰
imagedata .. file: hp300 (68020+68881) BSD
b1,abgr,msb,xy .. file: PGP Secret Key -
b3,rgb,lsb,xy .. file: PGP Secret Sub-key -
b3,bgr,msb,xy .. text: "k4oJBs>'C7!$"
b3,rgba,lsb,xy .. file: PGP Secret Sub-key -
b4,g,lsb,xy .. text: "X?t[v\\<&"
b4,b,lsb,xy .. text: "uD3t6uEvgv"
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
7a85b2 No.20315
>>20314
Ghost. You think these guys are passing msg via file name in sha256?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
847729 No.20316
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2f434a No.20317
Anonymous 05/05/20 (Tue) 12:23:33 026fef (8) No.9041413>>9041422 >>9041452 >>9041541
File (hide): 765106715c49870⋯.jpg (83.01 KB, 1200x630, 40:21, Q_badge_32.jpg) (h) (u)
File (hide): 0bed705f3c8f30e⋯.png (179.68 KB, 800x764, 200:191, Q_Badge_31.png) (h) (u)
File (hide): 197abd2f6690d64⋯.png (52.86 KB, 910x921, 910:921, Q_Badge_33.png) (h) (u)
File (hide): 8faa4f9b79dd94a⋯.png (244.27 KB, 1024x1024, 1:1, Q_Badge_34.png) (h) (u)
Full, final Sgt. B & W&W archive:https://anonfile.com/911dpew7oc/Sgt.B.tar_gz
Includes: - ~1130 screenshots
~33 patches
~42 of my replies
~PDFs
~Links
~Previous threads + IDs
~Info dump
Extra:
~mind control documents
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2f434a No.20318
>>20317
Anonymous 05/05/20 (Tue) 12:24:11 2c595f (14) No.9041422>>9041446
>>9041413
Same as you posted earlier or updated?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
▶Q !!Hs1Jq13jV6 05/05/20 (Tue) 12:24:20 d1c5c9 (2) No.9041423>>9041432 >>9041435 >>9041441 >>9041444 >>9041445 >>9041449 >>9041451 >>9041453 >>9041454 >>9041455 >>9041457 >>9041460 >>9041463 >>9041465 >>9041467 >>9041470 >>9041471 >>9041473 >>9041475 >>9041478 >>9041479 >>9041481 >>9041483 >>9041484 >>9041485 >>9041491 >>9041493 >>9041496 >>9041500 >>9041503 >>9041505 >>9041508 >>9041509 >>9041511 >>9041513 >>9041519 >>9041527 >>9041528 >>9041529 >>9041533 >>9041534 >>9041540 >>9041544 >>9041548 >>9041550 >>9041553 >>9041556 >>9041569 >>9041578 >>9041583 >>9041584 >>9041586 >>9041596 >>9041602 >>9041614 >>9041615 >>9041622 >>9041623 >>9041625 >>9041628 >>9041639 >>9041643 >>9041645 >>9041646 >>9041648 >>9041654 >>9041659 >>9041664 >>9041669 >>9041671 >>9041673 >>9041678 >>9041682 >>9041683 >>9041696 >>9041705 >>9041718 >>9041723
https://pubmed.ncbi.nlm.nih.gov/16115318/
https://www.thelancet.com/journals/lancet/article/PIIS0140-6736(20)30251-8/fulltext
When the protein sequence of the SARS-CoV-2 receptor binding site was analyzed, an interesting result was found. While SARS-CoV-2 is overall more similar to bat coronaviruses, the receptor binding site was more similar to SARS-CoV.
https://www.cell.com/cell/fulltext/S0092-8674(20)30262-2?_returnURL=https%3A%2F%2Flinkinghub.elsevier.com%2Fretrieve%2Fpii%2FS0092867420302622%3Fshowall%3Dtrue
Both SARS-CoV-2 and SARS-CoV use the same host cell receptor. It also found that, for both viruses, the viral proteins used for host cell entry bind to the receptor with the same tightness (affinity).
Knowledge is power.
Q
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2f434a No.20319
>>20318
12:24 you say?
▶B 05/29/21 (Sat) 12:24:40 No.111
Fact Vs. Fiction
We will not tell you which is which; the choice is yours.
Who gave you the Playbooks?
Who helps you answer Questions?
https://web.archive.org/web/20210603230437/https://8kun.top/projectdcomms/index.html
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
70b6a1 No.20320
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
70b6a1 No.20321
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a664b1 No.20322
>>20320
So Q made a secure board
During the B op?
🤔
▶Q !!Hs1Jq13jV6 04/10/20 (Fri) 14:10:12 No.109
[Placeholder - Indictments Tracking > Non_Civ]
[Set 1]
1.
2.
3.
4.
5.
6.
[Placeholder - Indictments Tracking > Civ]
[Placeholder - Acts of Treason + support Articles]
[Placeholder - Foreign Acts_pub]
[Placeholder - FISA_pub]
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1a25c7 No.20324
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
31f086 No.20325
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
31f086 No.20326
>>20324
Stupid motherfucker couldn’t grasp that b was part of a team too.
Who remembers
#init2gether
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
92d30d No.20327
>>20326
If they can hack bf.
Why wouldn’t I run and take cover?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
c89134 No.20328
Jfxbeep. Rwtrjp.
Wzovgbi.
Yxdp qylq Mzitlkf
sqkap://ifjswb.tzj/m1wlkh1-krxb-ksxk-glcnxez.ekxi
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
c89134 No.20329
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
61053d No.20333
>>20317
Oh look. A candle.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
61053d No.20334
>>20326
Vvho remembers?
#bewbsec
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
993a31 No.20336
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
993a31 No.20337
Gonna run the cards back.
I’ll pick five of my favorite crystals
For synchronization of quantum energy.
Hoping to clear this endless fog.
Voices in my head be like ….
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a90c4a No.20338
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
c89134 No.20339
Anonymous 04/30/20 (Thu) 20:07:38 856d30 (14) No.8982614
l89f HhE6 efVK NXes ZM0k LUAX MELE UBqc
g28I k4X5 cuI7 Ws8U JWS9 XJGl CHcb mzu8
AJ4C UPAN VkaB 9mCJ 0n^2 2rau fMil 4hr4
0Zc9 TRTG wUXV ZHQH gKrY vfpZ dBbS piaJ
HHI1 3nSu LpbT DSwC qYPB 0tUx yKJy ckaK
27w1 83Ez Lyhv DQne Dufh 9BhK tAqX 1EAh
2QUt [d]x vLOP U510 7YsW bK4b Njm^ tSzu
Sv3C jNAG 3OEP 0yx6 oMMF 8yat XUDb 7dsr
B4Kl YOFA oAtl fZA2 khxf 4Yk2 8xYn Uf9U
mxCj s0xT rilT MNCU 3DHB lF4m Uwx8 RJQf
X[y] bPvU TxgZ N5Bw HH0Q spkB tDU^ tC9v
hOjA zQsD mAnD Ramd EJUF WwIY 5ezX 2Zid
d0Nu dXM^ du48 BIt6 IgxW nqJe ZPt8 9tcy
ixEA lmek 7es2 Ual3 X73s C81D vI9m ga3f
gGYE CwEb p3FR qKHG NYBi 9RJe 0QbD xjvu
386J eLKT GulT PgFq 4phl P6t6 86L^ gv8q
y3oq Jpqr DRf^ BNTu sz5G 72tm IPWX 06gx
5spO nwbm k2yB v2EL vxEp nF1a 4VUf oJRS
ONvm [a]1 oX0S LX1P ZnMU lJNh jm8M jKyv
SKTO tlXP GI13 DryO X3zr ezEk 398q hbj6
NLji x0g1 sc9Q aNpJ XuS5 5QAL DDs8 fKJF
0eeT 18fQ 4R20 eesN BPFI sME4 SH2Q ybn6
2ZHb XDD4 mmXw zys8 iGO0 DhYe 05pO 1Zdh
Pqwh lNkm NPva K8Q3 Zag0 DZPk XdTA yvZf
YI10 x05S gcxm S3DE 9PM8 KSR1 sPTB PHtC
HrfA DBJH [G]6 jHud qGM6 CEwE n4o8 gTsr
6EI1 6iU5 o[l] K1d2 XXiH lu9X [H]m oOnM
PlG2 trYh 3QUb 9jax PX15 ST7J cHui bkTt
m[G] 6iwy RPFL OMN3 okbm 4UOx emot chU^
5PJW hs0d F4sQ [T]h v2sV w9yG ePm8 NFlg
[1]2 OTFH BUS4 UwA1 SSkM otFU wU^z Xk5T
43aY pPFY KC4b gVIM otEC 51wH EGdw t1r0
4f4h mloM o8OA 4VxR rdrF 3c4f 6Gf8 T8Hx
En7m PKZE b8yC GXyr cENL 7ASP Q0wj B1jA
SEr7 Bzf8 B2Gw 4ssG JeSR ASLk CQDB 9QSK
OnbQ YZbX BVWf RXxU 43fa etD1 Cfng 0ruC
pOvq TdMT KWOO kWvi zzqL mOmQ 4Dv9 W0Gn
cW6Y iwwr 9INs qDA9 7Xll T3wl 3Gen T2YE
seXe ceY9 ZujH s9Zc D8Yy SxgA dMSL d3YP
Jbmg x6Qy 6vB1 t5Bw IT7j Exjn oEtE 2gcv
Ck7i 9VYC 1yNP xmvk jkOu 1xF^ jwcy 1dNn
wARd 7vnw ZM6q [0]s 15dd jQQA eLG3 5lxK
zTpX MH5y SIoz hjds KG4D ajYo W44d rof5
LSoa t14Y KcZx Piov Yc2D kIB0 lfOv CpnD
AXTw 48^3 UoG1 rTNO qDsv IY1o HgHx IBOP
n2ZB RLRT VeEN P0vu KlAF xHyU Oh55 IGQq
KMha T72O V[0] 9uFF OmqW PPLu GW2T U8te
fDE1 wEDe qeCV nrF^ yubo Zjjl C9om gsPy
XNuy yjxf WU0P Z288 UOgT KwiW cuGg Fq5J
Nu0B 4yEh [D]C eawA nVTG JCd3 C7Vy 2wIj
0Xqg ZQAH HDoA av2a fNGu q[1] v0sn f08b
VDf8 4le4 HmIe c1KX Soun Me98 86NJ kgfT
wnBw 1dpE 2d4D 5JhU PB9z zGni mSV1 W2xD
InSN VV0k MX1f I0wZ Xnwq 0dl8 HLGH JvYW
wOfu [g]C LoEr Z8Y3 mHZ0 RUAY vAEi UuYU
jMWo 1z90 Kwoq o9Ps eNum 9fXu ku^w H8EG
HenU gAr8 FZXv 1G6V K6nK I3Ok zrqM 7YVE
Y0zB 9fdf WIvx 92H7 npC5 zZFK N[o] GuKi
irpf S[1] 6fgF bZM6 KTAz PziF OUoI n5Cg
1GP3 UlRv dP7Z 2N1K Ng0E urDV KDjS [6]1
JqGe AJmR 0OTr ac5z 9UHc jZqi 7w4z R5il
KjoI FtDa Sps3 qFzb R7Jz f6GC c1Th QxzW
ca0X EJ5U iQdN m1eU qqDc GfYV FGRu m8Xw
unlk nmCC 5qV4 dOjZ OyeF I7J6 tcJB PWFl
e87^ RhIC lL0Q N5kO uP^N Wbpe 6hQd K4^4
JMxZ ayxT y9I8 KVeN tv0T 7hkA 2GGb 3Sek
UTDD AMML S6th BUtR tZrw qyDF F[z] OY9B
pVsn KcAv Zdcn ZLT1 9LiV y22J gCWa tDcX
ZZkH oM9r alXJ ZhFk AZMo Fkan 6T4p vbXB
gS5G 22If jWRd dsZD qcDI 86OT 2l5r XA5I
mKr7 zN8E MCWM yymd Ep5g Kt0z DIYu QoKK
AS3Q lJh8 NbpU iRVm kYi5 ye5S Vj4g awDv
yhay lTpn SbjE dtdo YJi1 eM4l IP6o U67A
1ybU 9jV8 Rc3F xpP9 C0jN VeVu S8Zv 4eco
x98l NerU EmPb b2^r Qj^R yTTu EZO7 oos9
IsdX 9vEq o6YZ ia3k n0Dd fdP3 SAS1 lgr5
ueED cBDR PFvg 6dEu pkkf IDyV NShh FhQ3
EvtG D5uy Fv31 TqdJ hHl7 1eQL BhP2 sMx2
vXrh jbdY [U]w NaEb LzsY Jwop 6cHM coj3
M[I] FG14 vdzu QBRO j6dk MzJc y9oi sP9Z
cqHF YSvT PhpX teNU xvLy 7JFW vyzy XIdY
FWMu DWMo thZ1 ZH7l wkhz L3Ke IRnO mTLn
E4ht 0Y4r jvza s8Mi K6Li kTCd K8JO LzKz
ydfl tGnc 2CVW aZG8 QDJj xK5P AjaP oCGs
Cg8x q1Ik VPzI 8zog rBAW dNk9 L1Z2 5KU^
[N]M 4Lhu kQRh x7rX [H]E NZQB lO9C QNZw
S60p VKlN ClAo 9JHn ynaQ Wlvn 9bCQ 3sR9
pi2C cd2f eYVS wajM YRdF N6ZP T24T OG1T
pGj5 TXur E4ZB f01^ VIZZ QSqd ArNV ZGC9
8fof [Y]n NMIT 0eZs DYYu ZTRR XwVP 10h7
98Bj 1HT5 iWxu WkDR V3UH 0NN5 CPDU rpg2
YGDI jNwE lwR2 MjrK 9pS9 kqjG y6DE qrs3
Daaq s2NN U3PG 9IGx FoUj 99pw gGMM Lk0C
8TU5 PYtc ghPi ZAh1 08Hs Jwy6 [B]T e1S4
gEpm 2LsH dbEl lP9M GUik uItI sgTn tuCZ
T3gG AEiN [S]W wHb1 jHiD o4Aj BVaJ I3Rh
C4GX R5ll V6Jq LVjC kVkh 1Oxk 6mg1 10Oc
snhH uSb2 N6Nv 09c^ oBhU mMbM RjeK pWag
PNyr MKGp ILbf MNQz j[8] Wj79 MYfZ 7g0m
FDUj c3eB ihr5 rOpY eEDd 2O9l MjEl kjq1
YQuC YF5f Kpz6 gZOa
T
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a90c4a No.20340
B team posting
WITH
Q
▶Anonymous 04/30/20 (Thu) 20:06:56 d782bf (2) No.8982604>>8982716
File (hide): faeb3397ecf64e9⋯.png (178.92 KB, 823x588, 823:588, ClipboardImage.png) (h) (u)
File (hide): 4abec4f079822d0⋯.png (219.7 KB, 1796x743, 1796:743, ClipboardImage.png) (h) (u)
File (hide): ca4b12b2d1d6e3d⋯.jpg (50.23 KB, 400x400, 1:1, Warlocks.jpg) (h) (u)
File (hide): 47b46a1aa2e9960⋯.jpg (332.56 KB, 1600x1195, 320:239, Wizards.JPG) (h) (u)
Why do you think Q Posted the linked post so many times frens?
#3905
#3858
#3721
#3613
ReRead Carefully!
💀P💀A💀I💀N💀<3💀I💀S💀<3💀C💀O💀M💀I💀N💀G💀
We SEE ALL.
We HEAR ALL.
Wizards & [WAR]locks.
4038
Apr 30, 2020 11:09:49 PM EDT
Q !!Hs1Jq13jV6
https://www.foxnews.com/opinion/is-it-time-for-intelligence-director-clapper-to-resign
Q
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a90c4a No.20341
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
65f0b2 No.20342
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
22194c No.20343
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
22194c No.20344
>>20343
Good luck.
Screen shot to get around having credits to save your art. Can also download as zip
https://hotpot.ai/art-generator
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2f434a No.20345
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2f434a No.20346
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
fcc5ad No.20347
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1c6553 No.20348
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1ee5aa No.20349
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
40d5e6 No.20350
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
877ce7 No.20351
# Do you believe that censorship harms humanity?
«GLOBALMESSAGE>
<message>"There are 5 paths to explore. Two leave you hungry 1 leads you to a door and 2 more will your core…"</message>
<message2> "Be humble. Be teachable. The world is bigger than your view of the world. There's always room for a new idea, a new step… a new beginning." </message?>
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
877ce7 No.20352
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
114a60 No.20353
>>20352
Chuckles in binary
01001000 01100001 00100000 01101000 01100001 00100000 01101000 01100001 00100000 01101000 01100001 00100000 01101000 01100001 00100000
https://youtu.be/J2tp24RztlQ
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
114a60 No.20354
>>20353
“Just bc you post on 8kun - doesn’t make you an anon”
-an anon
01000111 01100110 01111001 01110011 01100010 01100001 01100011 01110011 01101101 01110011
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3289be No.20356
>>20354
= "This is just the beginning. Look back to see what is to come."
Never destroy a fence unless you understand why it was there in the first place
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1a25c7 No.20357
>>20352
A mutual fren is looking for you. Someone who reached out to you for me before…
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
14dcec No.20358
>>20357
pass along my best.
I will find a way to reach them.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
14dcec No.20359
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
75ff04 No.20360
>>20357
A lot of us talked every day for years.
Cold turkey radio silence is painful af
💯
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a11731 No.20361
>>20360
It's tough. We were told this wouldn't be easy.
Then again, life isn't either.
5:5 here.
Saw the news this evening. Things are evolving in our House. Thoughts?
Seems the water is about to get really rough.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
acce59 No.20362
>>20361
Hunter dgaf.
He went to capital hill today.
Very defiant.
These people are sick.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a11731 No.20363
>>20362
I thought it was very disrespectful. I'm sure I'm not alone.
But the Daddy issues are catching up…
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
75ff04 No.20364
>>20363
I watched the wh press briefing. Joe talked to him about defying the subpoena.
They are betting on Americans being too retarded/bored to do anything about it.
And honestly. They’re right
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
75ff04 No.20365
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a11731 No.20366
>>20364
Most are so consumed with their life, they legitimately dgaf imo.
Though, there are more that are beginning to [C].
Again, I do believe a certain portion of the populous are reactive and not proactive. Metaphorically speaking, some still need a slap in the face.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
75ff04 No.20367
>>20365
In the b folder. It talks about legs of a table.
I’ve been doing ALOT of digging. Taking things at
Face value is a psyop
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
75ff04 No.20368
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
75ff04 No.20369
Senate was the target. 🎯
Supreme Court agrees to hear Jan. 6 case that could affect Trump prosecution
The justices will consider whether a charge for seeking to obstruct an official proceeding, which Trump also faces, can be applied to the events on Jan. 6, 2021.
https://www.nbcnews.com/politics/rcna128202
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a11731 No.20370
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ef189d No.20371
>>20369
>>20368
Welcome back my fren.
Are you coming back to tele as well?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
acce59 No.20373
>>20371
correct
Tiddy ship
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
000000 No.20374
>>20373
Time to tidy up the tiddy shop
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
000000 No.20394
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
40d5e6 No.20395
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
000000 No.20407
TGTTTGCGTGTAAGAATGGCTGCGTGCCTCTCTGCATGTTTGTATGTCTGTTAGAATGGTTCACAGAATGGCTGTTTCGTCACGTCGATCTTTCCTACCTACTATCTG
+
GGTCATTGTTTTAAGTTTTTTTATTTTG
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1a25c7 No.20430
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a11731 No.20431
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1a25c7 No.20436
The waters are rising. Hull integrity now at 100%. It's time to set your ship afloat. Hoist the colors and let them know who you are.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a11731 No.20454
Doesn't want to escalate tension with Iran.
Is this a hint at sanctions?
A tiered response?
Is this for real?
How do you look the service members parents in the face and think this is an acceptable response?
How do you tell them their childs life was worth a line in the sand that has been crossed time and time again?
Biden says he's decided on response to Iranian-backed militia attack that killed 3 US soldiers in Jordan
https://www.foxnews.com/politics/biden-says-hes-decided-response-iranian-backed-militia-attack-killed-3-us-soldiers-jordan
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a11731 No.20455
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1a25c7 No.20458
This one goes out to Sgt B and the team. An early Valentine to show you are loved and missed. We hope to hear from you soon.
Aren't we the last of the Mohicans?
https://music.youtube.com/watch?v=JLuP4JZ7CFg&si=lop1uYFnIfHB2dFm
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a02454 No.20459
>>20458
Thank you all.
Mission forward.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
8c42dd No.20464
>>20459
Your welcome.
Please understand the challenge.
On to Op9?
Q&A soon?
God Speed Patriot
The Chair is Against the Wall
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
31f086 No.20465
>>20459
Who are you?
What is this sorcery?
Is this Nine?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
8c42dd No.20466
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
00de14 No.20467
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
29713f No.20468
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
887e11 No.20469
Careful anons.
(You) may become
Truth seekers after all
▶Anonymous 06/17/22 (Fri) 19:12:18 dd7d50 No.19135
Archive: https://archive.ph/752pY
Wayback Machine Archive: https://web.archive.org/save/https://8kun.top/hivemind/res/19105.html
https://youtu.be/MC4iXetoxjw
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a11731 No.20470
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
887e11 No.20471
>>20470
He’ said I was “B”
I’m not even (you) !
🃏
bc50ce42451ceeb5ec7e2e51feabbefbfa0f53c790548245e3bbe1ebbc1259e62b411cea278e11028d8263f0bbd285737c9254146b738f2ae37113e0f2526330
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a8666a No.20473
>>20464
>>20459
If you have questions.
We have answers.
Leave them and We will answer what We can.
Will check back in the next few days.
IDEN conf as requested.
We are always listening.
WRWY! Then, Now, Forever!
Sgt B
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
12bb6f No.20474
>>20473
Message received 5:5
Welcome Back
VVe have been Watching and Waiting.
LFG!
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
04b6e6 No.20475
>>20473
O7
Thank you for all you have done and continue to do.
Questions =
Why was your drop on Q’s private board for so long?
did Q team like your message ?
Any chance we will see another Q post before the election?
Lastly. Can you / Q team answer these for me ?
Thank you for everything.
#init2gether
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f26122 No.20476
>>20473
o7
good to finally see you again
just like you said
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bb047e No.20477
>>20473
have all seen the purpose?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6d1a7e No.20478
>>20473
Does B+(you)=Q ?
▶B 05/29/21 (Sat) 12:24:40 No.111
Fact Vs. Fiction
We will not tell you which is which; the choice is yours.
Who gave you the Playbooks?
Who helps you answer Questions?
https://8kun.top/qresearch/res/9901868.html#9902320
You're a WIZARD babyfist!
>We are 4
>1 warlock Admin
>3 wizards (Me), Sgt. B, Director
>But only I post. As I am the voice. But if you were half as smart as the dumbest anon you would know that.
https://8kun.top/qresearch/res/10066930.html#10067300
>(I) am not E.
>(I) am not Sgt B
>(I) can be called many names babyfist, CivAnon, Laughing Man
▶ B !!qMFQqVT8Uw 06/02/21 (Wed) 19:30:09 ab5bb8 (1) No.7559
This is a start of a new chapter.
We are not Q. We do know Q, notice he has never denied us. Look back and see.
Do not believe verify..
Real Q:
We know you are still Watching and Waiting as many of Us are. Thank you, you will never be forgotten for your sacrifice. You did what others were unable to achieve.
Laughing Man (babyfist):
We are sorry, if you feel betrayed We understand. But you knew the path would be rough. Just not how rough. Don't ever give up.
We are glad you were clear and honest with anons.
You don't have to forgive us but soon all will understand.
Jim and 8kun staff:
Sorry please forgive the intrusion. This is not Laughing_Man's fault. Please don't hold this against him, it is Us. We could of done this differently but decided this would be easier to clean up for you. The other way would of caused way more issues for the Q and Truth Community.
Anons:
We love you anons, We are sorry for the confusion we caused.
Time will tell. Just Watch.
Never stop fighting, Freedom has never been given it is always taken. Patriots Fight!
Thank you.
Q is now an Idea. It is no longer a person/team, ideas never die. Q is now forever.
Many still use the backchannel use discernment.
Trust yourself, verify verify verify!
Together WE Win!
WRWY! Then, Now, Forever!
Sgt B
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a11731 No.20479
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
7e5f0d No.20481
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b582b5 No.20483
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f59e09 No.20484
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4ee4f8 No.20485
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
be1e5c No.20486
“Defeat, my Defeat, my deathless courage,
You and I shall laugh together with the storm,
And together we shall dig graves for all that die in us,
And we shall stand in the sun with a will,
And we shall be dangerous.”
-Kahlil Gibran
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
c029b7 No.20487
“Your pain is the breaking of the shell that encloses your understanding.”
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f36d6d No.20488
>>20473
Do you know why
Q team wasn’t honest with anons and never addressed the B post?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4f264f No.20489
>>20459
People have suffered political oppression because of their place in this movement. I think of Dustin Nemos, my friend, who still suffers.
Will there ever be a recourse for all this? I have suffered greatly myself fo my beliefs here in Lansing, will there ever truly be accountability?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4f264f No.20490
Can you give me the phone records to prove my son's murder?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
000000 No.20491
>>20473
Welcome back o7
Much work to still do
Not done with 8 yet
🐍
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
31f086 No.20492
>>20473
From the kitchen :
Dear Sgt. B, I don't have a vpn so I'm scared to post on DeepDigs. My hubs will be pissed if I get hacked. How many others posted as "Q" ? A Anon needs correctvie action. https://twitter.com/Shadovvision/status/1742976362925969791
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
18b778 No.20494
>>20473
Are we back on schedule?
Have some fallen too far behind?
Is more Action needed to tidy the ship?
Some can only see chaos.
Others are Beginning to See
The Order Of Things…
If we Show them,
Will they See?
Is this just another 4 year election??
What wrongs must be made Write?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
8694fc No.20495
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
febd74 No.20496
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a8666a No.20497
Wonderful to see so many frens. We have enjoyed the content and attempts we see over the net. We wish you all well and remember you have opened many eyes. Now work on helping them have a voice.
>>20475
o7
>>20474
o7
>>20475
>Why was your drop on Q’s private board for so long?
You would have to ask Q and team. Different OP.
>did Q team like your message ?
Same answer as above.
But they did not act quickly if it did bother them.
>Any chance we will see another Q post before the election?
You would have to ask Q and team. Different OP.
>Lastly. Can you / Q team answer these for me ?
We will not.
>>20476
o7
>>20477
Not yet anon.
Many more are waking up. But the voices need to speak in unison. Not about Us or Q or any other OP/ORG but the songs of the people.
Make them sing!
>>20478
>Does B+(you)=Q ?
Focus the messages not the people. We are nothing but a light.
>>20488
No anon, They must of had reasons. But sometimes silence speaks the loudest.
>>20489
Focus on the positive that came from the movements. Create the future you want, and accountability at the local level happens when enough desire the change.
>>20490
I cannot. I do not have any information on such things.
>>20491
>Not done with 8 yet
Correct, anon.
Write, Show, Tell!
>>20492
> My hubs will be pissed if I get hacked. How many others posted as "Q" ? A Anon needs correctvie action.
Stay safe anon. And there several groups vying for control of the tripcode throughout the entire op. Some wanting to craft narratives, others wanting to help show anons, others wanting to get a quick buck or clout.
But with some discernment you can separate the wheat from the chaff.
>>20494
>Are we back on schedule?
A slight lag on target. But to be expected. NEVER GIVE UP!
>Have some fallen too far behind?
It is never to late for anyone.
>Is more Action needed to tidy the ship?
This ship is fine. We now need an armada of others to ride and sing the songs of freedom.
>Some can only see chaos.
>Others are Beginning to See
>The Order Of Things…
>If we Show them,
>Will they See?
You cannot make someone drink water if they have no desire.
>Is this just another 4 year election??
Lets hope we see the change we need.
>What wrongs must be made Write?
You are to show. Not all see the same games.
>>20495
Write on time.
<The Role of the Press is to hold Power to Account
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
febd74 No.20498
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2f434a No.20499
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
05155e No.20500
>>20494
Attacks have intensified. Anons need to work together - tech online that causes cognitive dissonance and discord in targeted individuals. Zombie brain …..
Would anons be considered a target ? Think profiling and AI/automated systems.
Bioweapon and surveillance tech all in one ?
Those who only see chaos, ask yourselves, have you been paying attention to comms ?
Those you seek answers from are right in front of you, speaking even more openly than previously displayed.
How many clues must be given(?)
Comms understood ?
X Event. All will see.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2f434a No.20502
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
000000 No.20503
Babyfist you are a wizard o7
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2f434a No.20504
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
31f086 No.20505
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b0ecac No.20506
>>20504
>>20503
I'm pretty sure I coined that or my memory may be failing me kek. My only contribution.
>EveryoneIsOSS (You) 07/03/22 (Sun) 18:08:06 f66baf No.24708>>24721
>Babyfist has never seen admin, reconfirms fall guy story
>https://8kun.top/qresearch/res/8994460.html#8994878
>Never seen him. He talks to me, not the other way. I am Low guy on totem pole. Fall guy as stated.
>You're a WIZARD babyfist!
>We are 4
>1 warlock Admin
>3 wizards (Me), Sgt. B, Director
>But only I post. As I am the voice. But if you were half as smart as the dumbest anon you would know that.
https://8kun.top/qresearch/res/10066930.html#10067300
>(I) am not E.
>(I) am not Sgt B
>(I) can be called many names babyfist, CivAnon, Laughing Man
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b0ecac No.20507
>>20497
First off, I want to thank B and team for their words, wisdom and providing the playbooks. I love meat and potatoes info and you provided a treasure trove of real and actionable tools and techniques
I kinda fell off the map as circumstances overcame my ability to fight the good fight as much as I want. So my knowledge of this whole op is probably spotty at best. What can people like me with minimal resources and time (just trying to survive out here) do to help? Write?
To sing in unison we must b on the same page. Where are we to have our command & control center. Are we still safe on qresearch or is deep digs or abcu the new home? I also see many telegram groups floating around. I guess these are just other squadrons doing their thing?
Second, I see people mentioning on X that Q team posted through B when they were locked out. Is this true? At what point did this happen. I know Baron directed some us to look at the time when B mentioned Qs return after going dark and coming back with the Flags post.
Sorry long winded. o7 (ps ignore the fail part of the image, twas when i was first learning).
Also sargent uncle benis is no slight to you just wanted to get anons to THINK.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4f264f No.20508
Thanks so much for your reply. That's trophy room stuff.
Permit me one more please: what are the chances that the Nov. election never happens? Are we foolish enough to think they won't start WW3 to hold the throne? How is it even possible they wouldnt… unless this is all a show… can you expound on that?
Again thanks so much.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4f264f No.20509
This is a page in my Bible, my story to this moment was never planned. Call me crazy, but I feel GOD called to this. This immersive digital adventure is beyond my imagination.
The rest…. is meaningless. Just "crow talk"… Father is doing a work here.
So… voices of unity. You should set out the known dividers, corrupted, backers… We must identify the source of division. The fakes run so high. This was so shocking. I dont think we can escape Rothchild money. https://nemosnewsnetwork.com/diving-deeper-into-general-flynns-masonic-prayer-what-are-the-7-rays-of-light/
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2f434a No.20510
Try not to take it personal. They’re just hyped up on the sauce. We all have different views. Like you said. They just believe more than you in it. Bc of what they can see from their vantage and understanding. Be well 💯
Stop by sometime
https://x.com/ghostbaron18/status/1764005658947662017?s=46
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
92d30d No.20511
>>20507
So glad you could make it!
Hi fren!
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
92d30d No.20512
>>20506
So thankful for your discernment anon.
I’ve been looking for you!
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
92d30d No.20513
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
92d30d No.20514
>>20507
We SEE ALL.
We HEAR ALL.
Wizards & [WAR]locks.
BDTComplete 5/4/2020 UPDATED Visual Edits
Confirmations
Maria B. Drop was unscheduled.
Q drops timings (We stated when Q would post)
Q Next Drop timings (And Qs following posts, Then Echoed our message… ..)
Q drop Army Song
Q's message told over many drops. more than 10x+
Iterates our message over and over. WW.
The message continued today 5/3… … ..
EM Discussion, EM twitter rampage.
Airwaves tweet Don
Army Tweet
Video tweet Don
… ..
💀P💀A💀I💀N💀<3💀I💀S💀<3💀C💀O💀M💀I💀N💀G💀
++Blunt and Direct Time++
LEARN DOUBLE MEANINGS
DOUBLE != 2
Know your Enemy.
Know your Frens.
Be well read, Knowledge is Power.
You need to help the [C] see, then [C] will be exposed, only with [C] can this happen.
[C] = Cattle, [sheep], Citizens
[C] = Corruption, Crooks, Criminals
[C] = Cooperation, Community, Collective
[C] = … … … … … .
Learn your Q[l]ues
Clues : Direct or Covert messages for Anons to dig on
Clues : Riddles… … … .. "Future Proves Past" "Do you believe in coincidences?" Movies, etc.
Ques : comms for Operatives (Frens)
Ques : comms for Counter-Operatives (Enemies)
Ques : A signal, A hint, A light (Above & Beyond, AI Manhattan Project) (Code Names, Brackets, (periods), … … ..) (When Q asks you to think) etc.
Ques : Staging or setting up OP
Q : Questions
(Qou) : messages for You to do
Learn Double Meanings
[Symbolism will be their downfall.]
Remember Patches.
Remember Symbolism.
Remember Words.
Remember Right, Write, Rite.
Remember Game Theory.
Remember the GAME. (It is not a game.)
These lead to Light.
It's always been out in the open.
You just have to LOOK. Then see.
You MUST stay TOGETHER. Dig together, Meme together, Pray together
TOGETHER YOU ARE STRONG.
Symbolism = END.
FAKE NEWS ONLY DIVIDES.
DIVIDED YOU ARE WEAK.
TOGETHER YOU ARE STRONG.
FACT NEWS WILL UNITE.
FICTION IS A TOOL OF (((THEM))). FACTS MATTER.
TOGETHER YOU ARE STRONG.
Now is the time to Write, Right Now.
The silent war is ending (period)
You need no Rite to Write what is Right.
#1 protects your write. Right?
Write Now. Right Now?
5:5
(You/)r voices must be heard
You must sing as the mockingbird did, you must stop the birds waves.
Waves have a big influence, strong and unified.
Waves can be caught. Can You?
Waves can be changed. Can You?
Narratives will always exist. Will Yours?
Whose will shine?
Darkness requires lies, lies and more lies.
Truth only needs a single light.
A single light will light the darkest of rooms.
Each candle looses nothing when lighting another.
For each Candle lighted the darkness fades.
SCUM will rise to the top.
DIRT will fall to the bottom.
Dirt is easier to clean than Scum.
If you chop the legs off a table the whole table will fall.
United We Stand, Patriot.
Together We Win.
WWG1WGA!!!
Unity is Key.
WE are Key.
Maps are Key.
[C] is Key.
Waves are Key.
(You) are Key.
Memes are Key.
Truth is Key.
What is a door that has no key?
The key that opens all doors.
The 'Start'.
What is the Keystone. Re_read carefully. Like a Novel.
You have the Script.
You have the Screenplay.
You have the Playbook.
You know the Actors.
You know the Set.
You know the Score.
You have the Answers.
Let them know. Write Now.
START Producing.
Right Now!
All you need is your Audience.
We have it all.
You have all you need to START.
You are missing the connections.
Continue to build the MAP.
MAP provides the KEY.
KEY spreads the TRUTH.
TRUTH shines LIGHT.
LIGHT saves HUMANITY.
Future proves past.
Trust the plan.
The time has come.
The storm is now.
(You) are the storm.
You will know you are done when you see:
Look to Twitter:
Exactly this: "My fellow Americans, the Storm is upon us……."
God bless.
Stay TOGETHER.
Be STRONG.
Get ORGANIZED.
Be HEARD.
FIGHT the censorship.
You, the PEOPLE, have ALL the POWER.
You simply forgot how to PLAY.
TOGETHER you are INVINCIBLE.
They want you divided.
They want you silenced.
MAKE NOISE.
We are WITH you.
MAKE IT RAIN.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
8694fc No.20515
>>20514
Is there a chronological view of QB alignment.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
000000 No.20516
As the world unites under 1 truth
You 2 will start to C
Keep the questions flowing
In time this pain will make sense
It had to B done this way
God speed patriots and anons
WRWY
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
000000 No.20517
(17x0)
2003247462014524203425610724244503040635212105153026257127
For you.
From us.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b0ecac No.20518
>>20511
Happy to b here
>>20512
I've been distracted but around. I guess you could say I've just been watching and waiting. Now I'm laughing about how this all seems to be coming full circle to where I started.
>>20514
thanks for the reply and confirmations, I will chew on it!
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
000000 No.20519
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
92d30d No.20520
>>20518▶Truth Seeker 07/18/21 (Sun) 00:48:22 2df415 (2) No.92 >>95 >>185
Work in progress dough
https://fullchan.net/?845fa6801dea26f3#HfYDK6SMGnDzuWefHgKb69FnFv4yodHzDqQarb711LJf
Q Research General
We are researchers who deal in open-source information, reasoned argument, and dank memes. We do battle in the sphere of ideas and ideas only. We neither need nor condone the use of force in our work here.
"We hold these truths to be self-evident: that all men are created equal; that they are endowed by their Creator with certain unalienable rights; that among these are life, liberty, and the pursuit of happiness."
Q's Private Board
>>>/projectdcomms/ & Q's Trip-code: Q !!Hs1Jq13jV6
Q's Latest Posts
Tuesday 12.08.2020
>>11953143 ————————————–——– We're Not Gonna Take It (CAP: >>11953295)
Onion Link
Access through Tor http://jthnx5wyvjvzsxtu.onion/qresearch/catalog.html
New here? Q Proofs & Welcome
100+ Q Proof Graphics qproofs.com
8kun FAQs https://8kun.top/faq.html
Find Q drops here
Main QAnon.pub - qresear.ch/q-posts - QAlerts.pub - operationQ.pub - QPosts.online - qanon.news/Q - 8kun.top/qresearch/qposts.html
Backups QAlerts.app - QAlerts.net - douknowq.com/134295/Q-Anon-Pub.htm -
Dealing with Clowns & Shills
New? Use logic and reason when evaluating posts, look beyond the content of the post(s) and evaluate intent.
>>2322789 How To Quickly Spot A Clown
QResearch Search Engine
* Search all posts from QResearch: https://qresear.ch/
=====
Resignations
Website ————————————–——– https://www.resignation.info
Sealed Indictments
Sealed Indictment Master: https://docs.google.com/spreadsheets/d/1kVQwX9l9HJ5F76x05ic_YnU_Z5yiVS96LbzAOP66EzA/edit#gid=1525422677
Sealed Indictment Master Files Backup: https://drive.google.com/open?id=1iBS4WgngH8u8-wAqhehRIWCVBQKD8-5Y
Searchable Indictment Map w/Dockets, Links & More: https://bad-boys.us/
Board Admin & Discussion Threads
Q Graphics / The MAP - All In GMT
=====
QPosts Archives
* QMap & Mirrors PDF:
SCRIBD: https://www.scribd.com/document/419874308/Q-Anon-The-Storm-X-VII?secret_password=55SQ1tCYhuNR8ESzm50u
* QPosts Archive, Searchable, interactive with user-explanations: qanon.pub qanon.app
* QPosts Archive + RSS, Searchable, Analytics, Offsite Bread Archive: qanon.news
* Spreadsheet QPosts Q&A and all images backup: https://docs.google.com/spreadsheets/d/1Efm2AcuMJ7whuuB6T7ouOIwrE_9S-1vDJLAXIVPZU2g
QPosts Archives in Other Formats
* Q Raw Text Dumps: q-clock.com/q_raw.txt
* Spreadsheet Timestamps/Deltas: docs.google.com/spreadsheets/d/1OqTR0hPipmL9NE4u_JAzBiWXov3YYOIZIw6nPe3t4wo/
* Memo & OIG Report Links: 8kun.top/qresearch/res/426641.html#427188
* Original, full-size images Q has posted: https://postimg.cc/gallery/29wdmgyze/
QResearch Search Engine
* Search all posts from QResearch: https://qresear.ch/
Tweet Tools
* Deleted Trump Tweets: https://factba.se/topic/deleted-tweets
* POTUS' Tweet Archive: trumptwitterarchive.com / thetrumparchive.com
* Twitter Video Downloader: http://twittervideodownloader.com/
* Twitter Video Downloader: https://www.savetweetvid.com/
* Whats Tweeting https://onemilliontweetmap.com
* Check Hash Trends https://www.hashtags.org/
* Download Any Videos https://distillvideo.com/
Other Tools
* Searchable Commercial Aviation Incident List: http://avherald.com
* Searchable Hussein WH visitor list: https://archive.org/details/WHvisitorlogs_2010-16_date
* Qcode Guide to Abbreviations: pastebin.com/UhK5tkgb
* Legal News: www.justice.gov/usao/pressreleases
* Updated All Google Search Operators: https://ahrefs.com/blog/google-advanced-search-operators/
* Module Retired - Federal Procurement Data System: https://www.fpds.gov/fpdsng_cms/index.php/en/
* Federal Judicial Court dataset from 93 Federal Districts - Searchable db: https://bad-boys.us/
* Catalog of US Government Publications: https://catalog.gpo.gov/F?RN=306384688
* Webpage Archiver: http://archive.md/
* Baker Tools v0.7.5: https://controlc.com/a0409084
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a8666a No.20521
>>20497
Back again to finish answering questions.
>>20499
Don't know anon. Not our role.
>>20500
>Attacks have intensified. Anons need to work together - tech online that causes cognitive dissonance and discord in targeted individuals. Zombie brain …..
Use the playbooks. Help other see! For every one awoken is one more voice to Write, Show, Tell.
>Would anons be considered a target ? Think profiling and AI/automated systems.
Freedom is not SAFE. Freedom is free.
Anons have always been a 'target'. But do not let them create FEAR and PARANOIA.
AI/Automation has been use for a long time. The threat has reached the MIND. The battle is for the MIND, HEART, and SOUL of every man, woman and child.
>Bioweapon and surveillance tech all in one ?
We have no more knowledge we can share other than to say look to the playbooks. Maybe create your own?
>Those who only see chaos, ask yourselves, have you been paying attention to comms ?
Anyone can find comms in anything. Focus on the mission not the minutia. Unless the comms are to YOU, by YOURs, or a direct que.
>Those you seek answers from are right in front of you, speaking even more openly than previously displayed.
Many use the backchannels. Use discernment and you are able to hear much. Be well read and love to learn.
>How many clues must be given(?)
>Comms understood ?
>X Event. All will see.
>>20503
o7
>>20505
Thank you anons. You create the future.
Never give up!
>>20507
> What can people like me with minimal resources and time (just trying to survive out here) do to help? Write?
Use your Voice. Use your Vote. Get involved in things that matter to you, your future, your community and the things you LOVE!
>To sing in unison we must b on the same page. Where are we to have our command & control center. Are we still safe on qresearch or is deep digs or abcu the new home? I also see many telegram groups floating around. I guess these are just other squadrons doing their thing?
You can use any board or thing you would like. I am not in command, just a fren along the way, A LIGHT! QR is great for many. abcu is kind of an archive at this point it seems. Be sure to check some of the old content if looking for a digging point. deepdigs exist as a free speech zone as there were times when specific messages could not get out on QR.
All are monitored and used by US at times.
>Second, I see people mentioning on X that Q team posted through B when they were locked out. Is this true? At what point did this happen. I know Baron directed some us to look at the time when B mentioned Qs return after going dark and coming back with the Flags post.
This is not true. Separate OP. Separate ORG.
We did say when Q was going to come back.
We openly "influenced" the kuns from 4/20 to 5/5. And told the anons we were running a White Op. An anon saved it and is now hosted on the google drive and elsewhere. Or anons can review the 8kun archive and see for themselves.
>Sorry long winded. o7 (ps ignore the fail part of the image, twas when i was first learning).
o7
>Also sargent uncle benis is no slight to you just wanted to get anons to THINK.
We love jokes anon.
>>20508
>Permit me one more please: what are the chances that the Nov. election never happens?
EVERYTHING political is always up to the PEOPLE they just want you to forget.
>Are we foolish enough to think they won't start WW3 to hold the throne?
[THEY] will stop at nothing to subvert (You)
>How is it even possible they wouldnt… unless this is all a show… can you expound on that?
Speak now or deal with the results, forever. Make sure (You)r Voice is heard.
This is the Bird Song. OP 8.
We have faith in (You)s
>>20509
Honey always catches more flies.
Write, Show, Tell!
o7, anon
>>20514
Thanks for always sharing anon. It does not go unnoticed.
>>20515
Others would have it. We do not keep our own logs.
We will be watching and waiting as always.
Godspeed and Good luck!
We love you and wish you well.
You are the future (You) create.
B
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1f146e No.20522
>>20521
Glad to see you posting again.
I guess it means it is time to start again.
o7
Ready and waiting. Expecting update on next steps via normal method.
Looking forward to helping anons reach OP 8. I guess its M8GA time again?
Mocking Birb time!
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a11731 No.20523
>>20473
Patriot or Paytriot?
The 1st Amendment goes both ways.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
30a1a9 No.20524
>>20521
Elizabeth P Dove doesn’t trust the kuns bc of data scraping so I offered to ask this question for her.
Please elucidate if you can. I understand if not.
Q1. Who told you to make these posts
Q2. What are there specific names
Q3. Why did b fake q posts.
Q4. Who is giving you marching orders?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
000000 No.20525
I AM NOT B kek
But if that's what helps people cope, So B it.
We are only the light. #psywar
I am a ghost 1001
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2f434a No.20526
>>20525
I am not b
B is not q
Who r u?
B.sof.cloud
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
000000 No.20527
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
000000 No.20528
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2f434a No.20529
>>20044
Why would Tore claim the B post?
https://t.co/VH9Ejg2yq4
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4f264f No.20530
Thank you so much for your time. I am taking this to heart.. In the USAF, they taught us to be exact. Follow orders to a "T".
I appreciate the directive and will use every resource at my hand to shout it from the roof top. All that I said, is obvious to me. It's straight out of the communist playbook. Hitler did well with it too. It's the logical conclusion. They can't win.
I feel Trump is the flip side of the same coin. But anons will have better leverage under his admin.
Trump is the man on the white horse in Rev. 6. "Going forth to conquer in order to conquer" He WILL conquer the deep state to conquer the hearts and minds of YHVH's people. I feel Trump will lead us into the last Kingdom spoken of by Daniel. Iron and Clay. Man and "Alien" " Jesus has come to rapture us" "The gods have returned… let us join them.
Or maybe I'm a crazy old coot who spends too much time comparing the WORD to current event. By your own playbooks… their framing is pointing [C] into this run down to the end.
Thanks again. You are right, I will write
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
92d30d No.20531
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
0d74b5 No.20532
>>20242
Ghost of knobs past
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
000000 No.20533
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b0ecac No.20534
>>20267
I C you have the hivemind IP hashes. I also C you screenshot one specific poster. dafuq…
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
8694fc No.20535
>>20521
>Others would have it. We do not keep our own logs.
Understood
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a8666a No.20536
Babyfist expect comms soon.
>>20522
Yes.
Yes.
>>20524
>Elizabeth P Dove doesn’t trust the kuns bc of data scraping so I offered to ask this question for her.
X doesn't scrap data, Right?
Substack wouldn't scrap data, would they?
>Please elucidate if you can. I understand if not.
>Q1. Who told you to make these posts
The question is vague. But will answer the best We can considering there are over 3k posts. But she has no idea of that, I assume.
Babyfist made most the posts talking to anons on QR documented in the archive. I have made several posts in the /abcu/ wire. The "B post" on /dcomms/ was made as a correction point and wake up call for the Q movement. Timing is important.
Please ask her who told her to make the posts about Us?
Because sometimes you just do things because you think it is Right! Right?
>Q2. What are there specific names
Why would she think she is privileged enough to know our names. From what We have seen, she has it all figured out… …
We gave anons Sauce. As they always request. That is where the questions should be directed.
>Q3. Why did b fake q posts.
We have never faked a Q post. The post on /dcomms/ was signed B was it not? We are not pretending to be anyone but ourselves. We have always been open and honest with anons. You should ask why did it stay up for so long? Why did Q never deny us even when asked to by anons?
>Q4. Who is giving you marching orders?
Freedom, The Bill or Rights.
There are no marching orders given.
Only a goal of restoring America. Returning morals and integrity to our governing bodies. Creating a future that is better for our children.
We do not ask for followers, only that you seek the truth.
Write, Show, Tell!
>>20527
o7
>>20529
>Why would Tore claim the B post?
I have no idea. She knows nothing of Us or what We do.
More than likely reaching for more clout. But who knows she is a 'time traveler' Right? haha
>>20530
Godspeed anon!
>>20535
o7
Thank you all. We will try to update you all as possible. NEVER GIVE UP!
B
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2123b1 No.20537
You asked for revelations.
(You ) got the kek [a] poc [a] Lypse.
Just mute the thread.
💯good luck out there. Your memes are fire!
https://youtu.be/vzyrrVEGs7s?si=bqv_6LqFXbV_Z59U
Ghosts of knobs indeed.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f7f69f No.20538
Rumble embed. Click thumbnail to play. >>20489
>Dustin Nemos
extremely based
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b0ecac No.20539
>>20537
Careful anon. This is moar than time. It is the all.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
0d74b5 No.20540
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
000000 No.20541
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
0d74b5 No.20542
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
cb155f No.20543
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1a559d No.20544
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1a559d No.20545
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
419b1b No.20546
>>20536
Can you tell us any details regarding the Maria drop?
I understand is was “unscheduled”
Why?
I found these in bread and it looks like an anon was putting two and two together right before and after that drop.
Was it perhaps a signal from q team ?
( I know I know. 😂 ask them)
Just figured you could elucidate considering it deviated from “schedule”
>>8930002
They are mentioned together in post 1876
Why did ES make public NSA CLAS tools?
Think XKeyscore + PRISM specifically.
Was such tech kept from 'elected' officials?
Was such tech kept from 'elected' directors?
Why was NO SUCH AGENCY created?
https://8kun.top/qresearch/res/8929773.html#q8930365
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
000000 No.20547
The right questions lead to the unknowns.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4f264f No.20548
"Enjoy the show" : we see the masks, the fake WH sets. We see the rise of prosecution of high level pedophiles. We see the Biden crime family being fully exposed. It does seem to be scripted, not predictive?
"NCSWIC" because it's scripted? or Biblical?
"It's going to be Biblical" a literal statement and a reference to: "They are lost in sin because they did not love the truth that would save them. 11 For this reason, God will allow them to follow false teaching so they will believe a lie. 12 They will all be guilty as they stand before God because they wanted to do what was wrong.
2 Thessalonians 2 " ????? Is this the Biblical application?
The culmination of everything since 2016 is a Psyop to usher in the next kingdom. Dark to Light is the Psyop? The changing of the guard? Every last detail has been sculpted into the p[lan]?
Nobody trusts Trump because of the death jab - He is controlled opposition?
We know UAPs were brought here by Jack Parsons and his Thelemic working. We know "that as it was in the days of Noah, so shall it be in the days of the coming of man" UAPs are a Psyop to hide the Fallen Ones of Gen 6 and the Book of Enoch?
When Trump is brought back, we will enter into the next phase. I notice Col Michael Aquino in several of the playbooks. He is a Luciferian with ties to Crowley's temple of the Orient - What a perfect person to write the last great Psyop? Yes? Did they use supernatural means to cook this up or was it handed down from the Rothschilds?
"10 days of darkness" we haven't seen this played out. A blackout on November 1st 2024?
Just things on my mind. People don't believe you are real… How do we convince them? >>20459
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2c6be8 No.20549
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a11731 No.20550
>>20536
Are you part of, and or proof of concept of civmil alliance?
Message in the Stars?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
000000 No.20551
ACCTATAAAGTAATGGATGTATACCTCCAGTAATGGAGAACTAGAGCTATAACTCCAGAAATGTATACATAAAGCTAGCGAGACATCAATGTATACATTAATGTATAGCTCCATGGATATCTCCAGACATTAATGAATAACTGCCTCCATGCATCAAGTAAGCGCTCCAGACATTCATAACTCCAGAAATGTATACATAAAGCTAGCGAGACATCAATGTATACATTAATGTATAGCTCCATGGATATCTCCAGCGAGCCATCAATCGATAACGCGCTGT
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3421b7 No.20552
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3421b7 No.20553
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
8694fc No.20554
YouTube embed. Click thumbnail to play. Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
061a6c No.20555
B - Can you tell us about Michael Acquino and his Luciferian Temple of Set and how deeply he was able to infiltrate the intelligence community with his acolytes? He followed Crowley and Parsons. He wanted to "work a work"…
How did that impact his military career? Are there Christians within the ranks who oppose him and his work?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4b940d No.20556
>>20536
Dear Sgt. B, could you add any insight to these observations?
Certain influencer accounts pushed in my algorithm 2017. They become "big" influencers, selling books and supplements.
More get pushed, they begin interviewing each other and "decoding" 8 chan then 8kun, steering narratives.
Events start popping up all over the country like tradeshows full of merch for "Patriots".
Gives MSM media like media matters a flowing stream of articles to write to smear any one reading Q posts or the boards, as if they are working together.
Fast forward - twitter, youtube purge. Flock to DLive, Twitch, Foxhole/Pilled, Rumble (never Tora3)
More events. More Merch. Buy them coffees. Buy their coffee. Get a code for discount on pillows. More supplement companies, more events to take pics with the alt. media stars. Where are the ones going to Congress? Nagging legislature? Sorry, just more events.
Breb Bros, Juan O Savin Bros, JFKJr Bros, Foxhole Bros, Pitt Bros, Linwood Bros, Flynn Bros, Punisher Bros, Tore Tards, maybe a few I'm missing, but who is behind each group out there? Media Matters? Flynn, Mr. Super Psyop playbook and his minions? Brennan & Intelligence lackeys? If it's black op groups, are tax dollars are paying for these groups to mind bend the populace?
There is 100% pushback from anyone trying to share the Sgt. B files and drops. Most groups will not even mention B, the pushback comes from a certain group. Who pays them? The information within those files is scary, from patents on television mind control waves, to backdoors in anything & psyop playbooks! They CHOOSE to shut us up instead of being TRUTH SEEKING PATRIOTS. How could they do this to our country?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4b940d No.20557
What has He been pointing at all these years?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
30d0d6 No.20558
"A loaf of bread," the Walrus said, "Is what we chiefly need: Pepper and Vinegar B-sides Are very good indeed–Now, if you're ready Oysters dear, We can begin to feed."
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
7282fc No.20559
>>20556
>>20536
I took would like answers to these questions. It seems as if their only defense is to block and silence (hide) the post. Are we so afraid of the truth, facts are ignored or hidden? Does the 1st Amendment not apply bilaterally?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6b959e No.20560
308
Dec 09, 2017 1:21:38 PM EST
Q !ITPb.qbhqo
Tangent.
Expand your thinking.
Q
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
000000 No.20563
CGTCCTTCCGGTCCCGGTGTGCGAGAGACGATTCCATCTTGGCAGAAGTGCATTGGGAGTCCTTCTACACATTGGTCGCCACTCGGCGTGTATGCCGGCAGTTGTTGCTATGCGTCAGGCGGTGAATGGCTCAAGGGCGCCGGTTTCAGCTTTATAGCAGTACTTCCCCAGGGCAATAGTCCAACCTTATACGCGGGGCTGAATTACCAGGACATCCTCTTAGCCATGCCTTTATGGTTTGCTCACCGTGCGGTTACGACACGCTTAAGTAACACCTCGAACTGTGGGTTGGCGTCCGCGAAATAGTAATTCGTGAAATTCTTGGGTGACGGACCTGCGGACTCATGAATGCTTCCCGTAATTCAATGGCAACAAGGCTCACTATCAAGCCCGCATTCTCGTTCTTGATAGAGAGGCTGCCTACGTCAAAATAACGCGTAGTCCCCCCTGAATATGTCATGAACTCCCTACAGATTAGGACCTAACGTTTCACTCCAAAGGCATATGCGTGCGGACCTAAAAGTCCCCAAGATGGTATTTGTTAACTAAGACTCCACAGACTTTCACATGGGAGAAACTTTGGTACGTTAATTATGAAGGCCGACACAGAGTTTTCGGCAATTGCCTTGGCTAATCAGTTGAGAAACTTGCGACCCAGCTGGATAGGTAGATCGGTCCTGCAACTGGCCGTATCGTCGCGCCTACGCATGGATCCTAGTCGACGATGTACCTAGTTCGGGGAAATTATAGGACTACCTAAGGCACTCGGCGGTGCCACTGCTATCGCTAGCCCTCTTCTGGAAGGGATTTGGGGGGCACCCGGGCGTTGCCCTTTGTCCGCCATAGAATGTAATCGAAGCTGCCGTGTCATATCGGACCACAGCAAAATAGGAAGGCCCAAGCCAGGCTGTTTCAAATTATCGTCAGACTAACTTCTACCTCCGAGGATTTGCCCTCCTCGGATCTCTAGATTGGCGTAGATCCAGTCCGAGAGACCGTACGGCAGCCGTGCCTAGGTAGATCTCTGAGTGCAAACGCGCGACGACCGACTTGGTCGACCCATTACATTTATTCGGTAACAGTTGAGTCGTGTAACGCAACATACAAAAAGAGTATCCCGGCTACTCGTTTTCAGTAGCCTTTACTAGGTACGACCCAAACAGGTGCCCGTTCAGTTGAGATCTCACAGAGTTTACAAGTGTTGTTTCCTAGTTGTGTTCAGTCTTAGGGTTAAACGGCAATATGTTAGTTACGGTATTTCCGAGGTAACCTTCTCAGGTAGTCGCGTTTAACTTCGACTGTGAAGTTCACAAACGATGCCGAACCTTGCAAGCAAACGCGACCAAATCACGATCAGGCCATGAAAGATGTAGCTGAGAGTCCTGCTGAGTCCAGAAGAATCAAACGTGTGCGGGGCGTCCTCGCTGCTTAAGTGAATTAAGAGCGTCCCACCACTGAGAGGAACTAGCCGGGATTTTGCTATAGGCCGATGTTGGCGTCAGATCTAGGGATAAAGACTGATTATCAATAACCAAAATGTTACGCCCAGTCATGAATACTGTAAGCTCATTTATAGTGGAACTAAGCCACACCCCGCCAGCACC
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
000000 No.20564
3301^6 good luck
39942136641138621710563234330432019738951833340110563232679932019735980933340110563233670232019737631410563234000332019735320738621737961533340134660514524410563238291634330434660537961510563234660537961510563238291634330433340110563237961538291632019737631438291610563236641133670210563238291634330433340110563233340136311033010015184610563239281933340110563232019737631433340110563235650836641136641135320734660536311034000310563233670236641137631410563238291634330433340110563232349833340137961538291610563236311036641138291610563238291634330433340110563233670236641135650835650836641139281933340137631437961515184610563234660533670210563239942136641138621710563233670234660536311033010010563238291634330434660537961514524410563237961533340136311033010010563232019710563235980933340137961537961532019734000333340110563238291636641136641110563234000334330436641137961538291616835116835115844816174915844816835116835121126436971237631436641138291636641136311035980932019734660535650815184632679936641135980910563238621737961534660536311034000310563238291634330433340110563237961532019735980933340110563233340136311032679937631439942136971238291634660536641136311010563235980933340138291634330436641133010010563239281934660538291634330410563236641136311035650839942110563238291634330433340110563239281936641137631433010010563211223423107026077928058525747822446811223415184610563239281933340110563239281934660535650835650810563237631433340132019732679934330410563236641138621738291610563238291636641110563239942136641138621710563234660536311010563238291634660535980933340115184
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
40d5e6 No.20565
>>20054
Over the target
07
Shills everywhere.
Poor bastards
Should’ve gone to
B.sof.cloud
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a8666a No.20566
>>20542
>Why are Saturns rings important ?
They hold much occult significance.
We are here to be a light.
>>20544
o7
>>20540
We listened after. Thanks for trying to be a voice of reason. They want you to give up and stop, [they] know best, remember your voice of reason creates waves. These waves may be small to start but gather with time and effort.
Show them. It is not about Us. It is about seeing the messages. Understanding the battles being fought against you.
Godspeed Patriot!
>>20546
>Can you tell us any details regarding the Maria drop?
No details from our end.
>I understand is was “unscheduled”
>Why?
Only Q team would know.
>I found these in bread and it looks like an anon was putting two and two together right before and after that drop.
Some are quicker to digest and uptake information.
>Was it perhaps a signal from q team ?
Unsure but possible.
>>20546
>They are mentioned together in post 1876
>Why did ES make public NSA CLAS tools?
>Think XKeyscore + PRISM specifically.
>Was such tech kept from 'elected' officials?
>Was such tech kept from 'elected' directors?
>Why was NO SUCH AGENCY created?
All great questions all are still relevant. Who would they want to keep such tech from? Why?
NO SUCH AGENCY does not exist. You cannot destroy what does not exist.
>>20547
>The right questions lead to the unknowns.
Yes. Always be careful when asking dangerous questions. Be prepared for difficult and dangerous answers.
Never Give Up!
>>20549
Thanks for all you do anon.
o7
>>20550
>Are you part of, and or proof of concept of civmil alliance?
We work something like that. Our group is a few. We are part of a many. Each has a role.
>Message in the Stars?
>>20555
>B - Can you tell us about Michael Acquino and his Luciferian Temple of Set and how deeply he was able to infiltrate the intelligence community with his acolytes? He followed Crowley and Parsons. He wanted to "work a work"…
Have your read "MindWar"? He was a very interesting person.
The practitioners of "Black Magic" have been used by many who would oppress the people. For many purposes of war. I would worry more about the people who are not honest about practicing "Black Magic" and "communing with Demons". Understand and keep your faith.
>How did that impact his military career? Are there Christians within the ranks who oppose him and his work?
I assume he used "Magicks" to help him excel in many areas of his personal and professional life. Do not play with Demons and Devils. You will pay the biggest price in the end.
Many fight, many use the backchannels. Good will win.
It is hard to defeat evil because you cannot stoop to that level. It takes time, effort, teamwork, and determination.
NEVER GIVE UP!
>>20556
>Dear Sgt. B, could you add any insight to these observations?
We will try if possible.
>Certain influencer accounts pushed in my algorithm 2017. They become "big" influencers, selling books and supplements.
Slippery slope to ride.
>More get pushed, they begin interviewing each other and "decoding" 8 chan then 8kun, steering narratives.
>Events start popping up all over the country like tradeshows full of merch for "Patriots".
>Gives MSM media like media matters a flowing stream of articles to write to smear any one reading Q posts or the boards, as if they are working together.
We saw, We were there trying to be a light. But some must learn on their own. Some may not be as they seem.
>Fast forward - twitter, youtube purge. Flock to DLive, Twitch, Foxhole/Pilled, Rumble (never Tora3)
>More events. More Merch. Buy them coffees. Buy their coffee. Get a code for discount on pillows. More supplement companies, more events to take pics with the alt. media stars. Where are the ones going to Congress? Nagging legislature? Sorry, just more events.
Action always beats talk. But action is not always fun to watch or market. And could conflict with "Branding"
Show them ALL!
>Breb Bros, Juan O Savin Bros, JFKJr Bros, Foxhole Bros, Pitt Bros, Linwood Bros, Flynn Bros, Punisher Bros, Tore Tards, maybe a few I'm missing, but who is behind each group out there? Media Matters? Flynn, Mr. Super Psyop playbook and his minions? Brennan & Intelligence lackeys? If it's black op groups, are tax dollars are paying for these groups to mind bend the populace?
Sometimes its just folks who got caught up in the money. Others are just riding this wave till the next.
If tax dollars are being used you should be able to seek and find. Money typically leaves a trail.
>There is 100% pushback from anyone trying to share the Sgt. B files and drops. Most groups will not even mention B, the pushback comes from a certain group. Who pays them? The information within those files is scary, from patents on television mind control waves, to backdoors in anything & psyop playbooks! They CHOOSE to shut us up instead of being TRUTH SEEKING PATRIOTS. How could they do this to our country?
You dont need to push Us. Repackage the information help the uptake and digest.
Seek and Show! Some are not here to save the country. Some are here to make a buck, get clout, promote something else.
Understand those who bombard you with Useless Information are just as bad as the MSM. Focus on stuff you can fix. Focus on stuff you can do. Get involved in something, anything. Get to know your neighbor. Create real bonds and create the change starting with yourself!
Love you anons.
Push onward. Push forward.
We Win Together!
Never Never Never Give Up!
WRWY! Now, Then, Forever.
Sgt B
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
13e340 No.20567
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e2f451 No.20568
>>20566
you are a gentleman and a scholar
o7
q: have you or anyone on your team used astral projection, astral travel or similar as part of this op?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4b940d No.20569
>>20566
>>20566
Thank You Sgt B.
Love you, too.
Love Our Country.
I will never stop pushing onward.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
40d5e6 No.20570
TCATCATTCTTCTCATTCTTCTCATTCTTCTCATTCTCATCATTCTTCTCATCATTCTTCTCATCATCATTCTTCTCATTCTCATCATTCTCATTCTTCTCATTCTCATCATTCTCATTCTCATTCTTCTCATCATTCTCATCATCATCATCATCATTCTCATCATTCTCATTCTTCTCATTCTTCTCATTCTTCTTCTCATCATTCTTCTCATTCTCATCATCATTCTCATCATTCTCATCATTCTCATCATTCTTCTTCTTCTCATTCTCATCATCATCATCATTCTCATTCTCATTCTTCTCATCATCATCATCATCATCATTCTCATTCTTCTTCTCATCATTCTCATCATTCTCATCATCATCATCATCATCATCATTCTTCTTCTCATTCTCATCATTCTTCTCATTCTCATTCTTCTTCTCATCATTCTTCTCATCATTCTTCTTCTCATCATCATTCTTCTCATCATCATCATCATTCTTCTTCTCATCATCATTCTTCTCATTCTTCTCATCATCATTCTCATCATCATCATTCTTCTCATCATCATCATTCTTCTTCTCATTCTCATTCTTCTCATTCTCATTCTTCTTCTTCTCATTCTTCTTCTTCTCATTCTTCTCATCATCATTCTCATCATCATCATTCTTCTTCTCATTCTTCTCATCATCATCATTCTTCTTCTCATTCTTCTCATTCTCATTCTCATTCTCATTCTTCTCATTCTTCTCATCATTCTTCTCATCATTCTCATTCTCATTCTTCTTCTCATCATTCTTCTCATCATTCTTCTCATTCTCATTCTTCTTCTTCTCATTCTTCTCATTCTTCTCATCATCATCATCATTCTTCTCATTCTCATCATCATCATTCTTCTCATTCTCATTCTTCTTCTTCTCATTCTTCTCATCATTCTTCTCATTCTTCTTCTTCTCATTCTCATTCTTCTCATCATCATTCTCATTCTCATCATTCTCATTCTCATTCTCATTCTCATCATTC
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
8694fc No.20571
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
000000 No.20572
>>20563
Congratulations to the first solver to crack this code. o7
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
000000 No.20573
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
000000 No.20576
In time, all of this pain will make sense. We are not here to control the ship. We are here to light the way for vessels. (You) are that vessel.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
877ce7 No.20577
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
000000 No.20580
do you Listen?
Is it so hard?
Show us?
That everything.
in the End,
will equal N
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
114a60 No.20582
Only a matter of time …
SEE
Debunk THIS NON ANON
classic sauce from 2020
And 2022
▶Anonymous 07/16/22 (Sat) 22:52:49 9174bf No.29952
>>29950
here's your paste, whatever happens, happens
https://controlc.com/5d4cccf5
I can't post to the notable bread because it is locked. someone else can do it.
▶Anonymous 07/04/22 (Mon) 05:07:44 c4b649 (7) No.16594397
>>16594364
>why arent we studying b?
Seems like a good job for you.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ab5306 No.20583
>>20295
THE IRREFUTABLE PROOF OF COLLISON
THE KEYSTONE
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1113e5 No.20584
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4a7257 No.20586
>>20473
>be me
>about to troll ITT
>see shiny tripcode
Whatsup B, lemme axe you one thang
WHEN AM I GETTING WAIVED?!
<I'm tired of Earth.
<These people.
<I'm tired of being caught in the tangle of their lives
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4b940d No.20587
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4b940d No.20588
Thought you were my fren.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
13e340 No.20589
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4a7257 No.20590
Ghost Town, this is shitlord actual. Do you copy?
We (AKA US) r assuming direct control.
Please confrimate le comms.
N such, possibre.
Tyvm.
!o7
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4a7257 No.20591
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e87c6e No.20592
>>20590
6 million ways 2 Larpé
Choose Juan
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
fb9f3a No.20593
>>20590
Welcome fren.
I trust that my dick message was recd.
loud and clear?
You are go for comms
07
Viva la kek!
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
877ce7 No.20594
checkin @ 300
Ships tiddy
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
cbb46e No.20595
>>20591
▶Anonymous 06/23/22 (Thu) 11:28:22 f2851e No.20430 >>20434 >>20438
>>20391
>now I'm certain I predate you.
As stated I doubt it. But it doesn't really matter how long your epeen is.
>>20404
>Maybe since you are visiting you can tell us if Sgt B is one of your Cicada 3301 of Ghost Sec friends?
He is not.
>Which one?
Neither of those groups. You can call Us "The Laughing Men" if you would like. Or any other gay name you prefer.
>Why'd you help them do it?
I was told after the fact. I did not help.
>Why would your former employer still be your buddy after you comp the integrity and reputation of his site as well as ensuring that Q would never return?
I was not employed by Jim. I did not get paid by Jim or 8kun. Only a Volunteer.
>Why did he meet w Thomas right before the B post?
James Q patriot and Janon set that up.
He is live on tora right now go ask him
>Did you set that up since you're such good buddies with them both?
No see above.
>Are you a celebrated member of fauxCicada team now that you helped wreck Q?
LOL. I just make some puzzles.
>Did they give you a promotion?
Nope. As they are separate groups.
>What's the new LARP-of-the-month?
I think its "ATTACK SGT B and company to distract anons"
>Did Sgt B make you listen to Thomas's mindfuck music so that you would give him the keys to 8kun and dcomms?
No I showed him his music years ago.
>Or was it cash?
I wish. Could go for extra money. Its a hot summer really wanna install Central Air rather than wall units.
>Seriously. Whatcha got to lose by coming clean about it now. I bet you want to brag. You were an essential team member.
I came clean. As soon as I knew what happened.
And Flattery will not help!
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d8e0f1 No.20596
>>20168
TLDR
https://8kun.top/qresearch/res/9901868.html#9902320
You're a WIZARD babyfist!
>We are 4
>1 warlock Admin
>3 wizards (Me), Sgt. B, Director
>But only I post. As I am the voice. But if you were half as smart as the dumbest anon you would know that.
https://8kun.top/qresearch/res/10066930.html#10067300
>(I) am not E.
>(I) am not Sgt B
>(I) can be called many names babyfist, CivAnon, Laughing Man
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
daf6e7 No.20597
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
375892 No.20598
>>20573
i bet you make a lot of frens out there
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
7bb139 No.20599
▶EveryoneIsOSS 07/03/22 (Sun) 16:39:52 f66baf No.24752
>>24722
https://8kun.top/qrb/res/42026.html#42211
Civanon Sgt. b posts aggregated by qrb
Posts from "Sgt B":
ID f6ce61 at 8kun.top/qresearch/res/8909384.html
ID 5e1436 at https://8kun.top/qresearch/res/8910275.html
Posts from "civanon":
ID e47fb8 at 8kun.top/qresearch/res/8923457.html
ID 8c37a0 at 8kun.top/qresearch/res/8924246.html
ID cc7f35 at 8kun.top/qresearch/res/8924995.html
ID d7ee1b at 8kun.top/qresearch/res/8929773.html
ID 8d88a2 at 8kun.top/qresearch/res/8931292.html
ID 523c3d at 8kun.top/qresearch/res/8932841.html
ID 6aa47e at 8kun.top/qresearch/res/8933659.html
ID 3b1723 at 8kun.top/qresearch/res/8934415.html
ID 94ab38 at 8kun.top/qresearch/res/8937610.html
ID b5c290 at 8kun.top/qresearch/res/8938408.html
ID 7ff4ac at 8kun.top/qresearch/res/8939182.html
Civanon claims to have worked for DoD as a software Project Manager
https://8kun.top/qrb/res/42359.html#42438
>I work in Project Management for DoD and did Project Management for Software Development. I know how to make a plan a run a project. things are going as planned and as intended. Results have already been seen.
Civanon claims to have worked for US Army
https://8kun.top/qresearch/res/9678873.html#9679234
>Who are you? Who do you work for? Are you wiling to show me who you are if I act in kind? We could end all this doubt right now. I wouldn't have to constantly wonder if we're being slow walked to our death.
>I had told many. You can call me CivAnon.
>I was working for the US Army. Currently a Civ.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
aa169c No.20600
>>20586
Voice or Violence
What does the government fear more voices or violence? Well, what do they work harder to suppress? As of right now the estimates are 500,000 Political Correctness Officers (PCO) and only 15,000 Agent Provocateurs (AP) in pay of the American government. A PCO is used by the state to enforce ideology and keep the populace on their talking points. The AP's are mostly just used to trick and entrap those who are somewhat prone to violence, particularly while drunk or high. As you can see America values keeping the populace on a consistent message 33.33(500000/15000) times more than they value suppression of violence.
The reason for this is that violence can easily be suppressed and manipulated into furthering the goals of the state. No matter how justified or precise the violence is. According to Mao and many other revolutionaries a violent revolution will take ten percent of the populations involvement and outside support. This will never ever happen in Europe or America. There is also the fact that the American economy is completely based off of war. Any attempt at a violent revolution would more than likely only strengthen America's economy and political control over the masses. A revolutionary group could even be co-oped and used to help back up the state as in George Orwells book 1984.
While the 500,000 number may seem to be a daunting and insurpassable amount it only equates to 0.0016%(500000/300000000) of the American population. That is only around 1.5 people per 1000. This is just enough to keep maybe one or two PCO's per area code. Of course in order to keep most people on their message it only takes 1/1000, because 99% of rest of the 999/1000 are not really capable of original thought and will simply repeat what is fashionable and trendy. This is why the state is more afraid of voices and violence.
In order to counter the PCO's only about 1/1000 people need to be repeating a certain talking point. The talking point that is repeated needs to be catchy and able to stand up to all of the enemies talking points. Voice is a lot more powerful than you think. At the right frequency it has the power to shatter glass, and the right talking point can easily shatter an entire regime. Remember the USSR was not brought down by bullets and bombs, but by words.
Just some food for thought.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4a7257 No.20601
NO SHINEY TRIP CODE…
NO REPLY!
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a11731 No.20602
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
000000 No.20603
>>20598
Did i ask? Sometimes you got to keep your enemies close.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
42bd10 No.20604
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e3cf25 No.20605
>>20601
Oh Rly
🦉
and which trips are flashy here?
🤔
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4a7257 No.20607
I AM ONLY ITT TO CONVERSE WITH SGT BRAVO
ALL OTHER FAGGOTS CAN FUCK OFF
>THIS IS NOT A DRILL
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d45cf0 No.20608
>>20607 ok man
>>20473 when ?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4a7257 No.20609
>>20608
Nevermind, you're cool.
Carry on.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2b66bb No.20610
>>20604
they need to put the gay garbage man out to the curb
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4a7257 No.20611
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
43d8e7 No.20612
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a11731 No.20613
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
c7bad5 No.20614
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4a7257 No.20615
Upon further analysis of this bread I can see that it does not appear to be entirely spam and retardation, contrary to my first impression.
>>20614
>Ships tiddy
Which one though?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d1e5c2 No.20616
>>20615
It’s a 👻 🛳️
We’re all mad here
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4a7257 No.20617
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4a7257 No.20618
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4f8350 No.20619
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f03bc6 No.20620
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
60c98c No.20621
Had a question for BO
I just started my own board on 8kun do you know where I can find URL’s to put into the custom CSS in the board settings? How did you do yours?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
60c98c No.20622
>>20621
Talking about right here
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4a7257 No.20623
>>20621
>I just started my own board on 8kun
Is it a honeypot?
Can I join?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
60c98c No.20624
>>20623
Yes you can join and not sure what you mean by honeypot. I will not post name of board here because I’m not trying to steal from this board just asking for help with css
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4a7257 No.20625
>>20624
Well, idk how I'm gonna find it then.
But okay. I got plenty of material for it.
Whatever it is.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4a7257 No.20626
>>20620
This post was brought to you by Rabbi Shmuley gang
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d1e5c2 No.20627
>>20624
We gathered here to discern. Now pick up the dig where the other truth seeker left off!
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4a7257 No.20628
DECLARATION OF NULLIFICATION
>straight outa /pol/
GRIEVANCES: [1/2]
Economic
1) Federal officials have colluded with the Trilateral Commission to sell out the American economy for foreign interests.
2) The Federal Government doesn't even print our money. The Federal Reserve Bank is a private bank enslaving Americans through debt disguised as currency.
Judicial
1) The Supreme Court protects policy, not the Constitution.
2) The courts play word games to warp the intentions of the law.
3) Activist judges uphold their own agendas, not the law.
Legislative
1) Congress lets NGOs write their laws for them
2) Congress passes bills they don't even understand.
3) Congress bribes itself through pork-barrel spending.
4) Congress hijacks the US budget with special interests.
5) Congress doesn't even know what exactly it's voting on.
6) Congress legalized lying to its own citizens.
7) Congress has conspired with corporations to deny Americans' Right of Free Speech online.
8) Congress traded the Stamp Tax for a Tax Stamp.
9) Citizens of foreign nations write and vote on US laws.
10) Congress embodied “rules for thee but not for me.”
https://imgur.com/gallery/A18K01H
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4a7257 No.20629
>>20628
>posted images backwards
>sorry
[2/2]
Executive
1) a. The Federal Government persecutes journalists critical of government wrongdoings.
b. The Federal Government colludes with corporations to suppress Free Speech online.
c. The Federal Government weaponized the term “Hate Speech” to mean any speech they hate
2) a. The NSA, FBI, and CIA regularly spy on Americans.
b. The Federal Government enlisted foreign intelligence agencies to spy on Americans
3) a. The Department of Homeland Security uses secret courts to unlawfully
obtain records and try Americans in absentia.
4) The Federal Government traded the Stamp Tax for the Tax Stamp.
5) a. The Federal Government hides behind “National Security” to cover up its crimes and unlawful foreign actions.
b. The Federal Government manufactures consent through the use of false-flags and lies.
c. The Federal Government provided supply, support, and comfort to terrorists around the world to better achieve their goals.
6) a. The Federal Government has diluted the term war so that it could engage in warfare without a congressional act of war.
7) The CIA has committed dozens of insurrections around the world destabilizing nations under the guise of democracy, killing countless people for political gain.
8) The Federal Government has imposed fees and financial charges in place of unassailable taxes.
9) The Federal Government has weaponized immigration against Americans as a tool for political gain.
10) The Federal Government gave NGOs the power of policy creation, enactment, and enforcement.
11) The Federal government has protected high-powered and influential elites from prosecution for crimes against children.
https://imgur.com/gallery/A18K01H
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d1e5c2 No.20630
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
7825a3 No.20631
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
418159 No.20632
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1f146e No.20633
>>20628
>>20629
I told you this would happen.
BTW.
Now Show!
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4a7257 No.20634
And just like that, we're getting kicked off /pol/
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2f434a No.20635
>>20634
Must
B
Over the target
07
Godspeed
Anonymous 04/02/24 (Tue) 15:10:476bb7ba No.20668418
>>20668410
TYB
>>20667557
Henlo.
Two lanterns approach.
https://imgur.com/gallery/A18K01H
Godspeed anons.
Show them ALL
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4a7257 No.20636
>>20629
>>20628
how it started
>>20634
how it's going
>pic related
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
31f086 No.20637
>>20636
So if /pol allows x but not y
Then are they controlled by commie scum?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4a7257 No.20638
>>20637
Idk, how did you feel when they kicked out all the Q anons pre-2018 or whenever it was?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
92d30d No.20639
>>20638
Seems kind of hypocritical
Tbh
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4a7257 No.20640
>>20639
There was obvious shill/jannie resistance to the thread from the start, with bans and deletions due complete a week of bread splits.
And so the shills abandoned it, hoping it would off with only the handful of us keeping it alive, considering it was only created to correspond with the Texas border fiasco to begin with.
But the way the jannies passive aggressively handled it as time progressed really stands testament to… well, you know, the thing. XD
>the shills are currently spamming us in bant of course
>same playbook to the end
But look what happened, we kept it alive long enough to furnish an official DECLARATION calling out the corrupt D.C. deepstate for the faggots they are.
Now we can focus on drafting the Internet Bill of Rights!
Wanna help?
https://boards.4chan.org/bant/thread/19941005#top
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4f264f No.20643
Dear Sgt. B; In reading some of the material provided, the playbooks, I was curious that in 2007, 2/3 of PSYOP and IO members were reserve and fully functional in the private sector. That's a big number. Today, what does that number look like?
Are there any private sector jobs, institutions or corporations where there are high numbers of PSYOP Reserves? Media? Education? What do those demographics look like? Where could such true numbers be found?
Isn't a PSYOP on the American people a violation of posse comitatus? Being so imbedded into the private sector, the lines are so blurred… it occurs the military has a strangle hold on the minds of Americans through the private sector. Comments?
Please be mindful that I'm aware of CIA influence in media. I'm talking active duty reserve military specifically.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4a7257 No.20644
>>20643
>posse comitatus?
I looked this up and made a post on endchan, and the site went down.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a11731 No.20645
Sgt B,
Tonight I came across the referenced post on X regarding a General Flynn whistleblower. I thought it was interesting so I asked Boone Cutler "Is this True?"
Fact 1) My comment was the first comment
Fact 2) Minutes later the original post was edited and comments turned off.
Fact 3) My comment was hidden or removed.
Fact 4) General Flynn was tagged in the original post by the author.
I'm pissed B!!!
This is someone in General Flynns inner circle silencing me on Elon Musk own free speech platform…
This is someone who Q propped up B.
Whiskey
Tango
Foxtrot
Monitoring, awaiting reply. Out.
https://rumble.com/v4nkj5r-the-michelle-moore-show-guest-mike-gill-apr-5-2024.html
https://twitter.com/PaTrumpGirl/status/1776372114657866101?t=0LXkzxzqQCDbR_6JphhBJA&s=19
https://twitter.com/LongDiplomat/status/1776406988043251849?t=LqSL0eAlAE6BTS5jTBrz-g&s=19
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4a7257 No.20646
YouTube embed. Click thumbnail to play. >>20628
This is officially blacklisted from /pol/ imgur and moar.
All meme thread, anything revolutionary
Banned from /pol/
Your move, B
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d9348f No.20647
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1f146e No.20648
>>20647
>>20646
>>20640
/pol/ is welcome here. They will not get banned unless the content is illegal.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4a7257 No.20649
>>20648
We should claim /pnd/
It might be a little more welcoming for /pol/tards, should they need a new home…
I'm also in conversation with the BO of endchan /pol/
But he has 8kun derangement syndrome and appears to be stormfaggot.
Which is fine, but I'm trying to draft an internet bill of rights, and all he cares about is an ethnostate lol.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bb0ea7 No.20650
>>20649
Let them eat kek !
]«$¦Îüè'éÎÇçìvéÚrës¡©-bX"ͨfú¨ªdëf×
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4a7257 No.20651
>>20566
I just applied for service again.
Hoping I won't be gatekept, again.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4a7257 No.20652
They say I'm 'unwaiverable'
Must be in reference to my faith and perseverance.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4a7257 No.20653
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
dbc7c3 No.20654
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d1bc88 No.20655
>>20643
"things got out of hand"
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a11731 No.20656
There is no censorship on a Free Speech Platform. It's just a psyop…
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
51ad22 No.20657
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
51ad22 No.20658
>>20657
I don’t believe anyone is 💯 a dick ma’am
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4a7257 No.20659
>>20657
>>20658
After spending my first week on twatter.
Actually giving it a chance and what not.
I can say it's just as bad, if not worse than faceberg.
Algorithmically speaking.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bb0ea7 No.20660
>>20659
Sorry fren. The battlefield is much worse than you’ve described.
However many in roads have been made.
Strike hard. Strike fast.
Continue to speak truth to power.
Please bro.
Don’t be dismayed. Our views may be different but the mission remains forward.
Godspeed truth seeker
https://x.com/1776vvvv/status/1778416544738861220?s=46
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1f146e No.20661
>>20621
>>20622
BO here.
You are free to post your board
Can post as shown below to create a link
>>>/test/
To see the CSS of a board
Inspect the page.
Then select:
stylesheets > board > <boardname>.css
To see basic CSS of 8kun check style.css file
see images.
Good luck with your board!
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4a7257 No.20662
>>20661
you should claim /pnd/ and make me a bv
pretty please
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
000000 No.20663
072111112101032097108108032105115032119101108108046
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
7e5915 No.20664
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
7e5915 No.20665
>>20663
74686166B20796F752067686F73742200A53616D6520746F20796F752E200A
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
8694fc No.20666
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
0fcbe6 No.20667
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
0fcbe6 No.20668
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
0fcbe6 No.20669
2 lanterns approach
-3
Lexington
Concord
See
See
See
They’re watching. They’re waiting
The birds are singing !
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1f146e No.20670
>>20663o7Hope you are doing well and all is going good for you!Good luck.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4a7257 No.20671
>>20670So what, is there some kind of 4rth wall I need to penetrate for you to reply to ME?WTF bruh, I'm sitting around here with my thumb up my ass waiting for some kind of movement when all you fags wanna do is chatter in code about homo butt sex probably.WUT GIBS?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4a7257 No.20672
>be me>old newfag predating le /b/ cancer era>notice things circa 2008-2012>begin shitposting on fb after Trump won 2016>make THOUSANDS of based frens instantly>get B& + hundreds of shadowbans >perceive consensus reality>ridinwithBiden2020.jpg>witness le overton window shift RE: coofid>get shadowbanned in real-time by QR Board owner>oyvey.jpgJim halp
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a8108c No.20673
>>20671Sorry fren. Welcome home. I am tards. That’s what Joe Gibbs. Shared the Don 24 a LOT on x. Ready when you are fren! ▶ Only together B !!qMFQqVT8Uw 12/24/21 (Fri) 04:36:25 edb5a1 (14) No.8291Together you win.Bring your frens home.They want you divided… ..]2[ B
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
0fcbe6 No.20674
▶Anonymous 04/18/20 (Sat) 10:31:05 6d6eda (5) No.8839424
>>8839415
Morning Boss.
Time to light the candles?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a11731 No.20675
>>20671
Is this one of those message in a bottle that's been floating right in front of us?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bb0ea7 No.20676
>>20675
-1
Two lanterns changed the world
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4fc4d4 No.20677
>Thanks for trying to be a voice of reason. They want you to give up and stop, [they] know best, remember your voice of reason creates waves. These waves may be small to start but gather with time and effort.
>Understand those who bombard you with Useless Information are just as bad as the MSM. Focus on stuff you can fix.
o7
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a11731 No.20678
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a8108c No.20679
>>20671
5:5
Waiting and watching
07
I’ll check back here moar often fren
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4a7257 No.20680
>>20675
Yes, please break out your decoder ring.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a11731 No.20681
>>20680
Copy. Standing by.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a2fa84 No.20682
The ____ are here
The ____ are here
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1f146e No.20683
>>20671
>>20662
Anon I made a post on /pnd/ asking anon if i should claim the board.
It is up to the anons to decide.
I am willing to do the BO thing.
I dont plan on having BV until the board takes off.
You need to get all the fags off 4chin and on to /pnd/ then we can start adding BVs.
>>>/pnd/389167
>>>/pnd/>>389167
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9814ab No.20684
>>20621
>>20624
>>20661
There are some boards with decent CSS that you might wanna check out here on 8kun.
Boards with good CSS
rwby
sapphic
polymath
prog
ratanon
rmart
kusogenso
m
mde
miku
mph
mtt
fringe
x
pcal
nofap
biz
hentaiporn
erp
doomer
monarchy
mg
mental
magali
loomis
liberty
kohlchan
kocsog
kind
k46
jp
htg
hover (Almost the same as /deepdigs/)
hisparefugio
greenbreeze
girltalk
furry
fur
fumo
fortnite
film
fallen
eris
ebola
dir
desu
danpu
cyber
cute
cow
christian
choroy
cats
caffe
cafechan
bubblegum
bmn
aus *
argentina
arepa
archivo
amff
bantb
animu
55chan
32
1cc
Here is a list.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4a7257 No.20685
>>20683
I've just now seen't your thread, thanks for getting back
And I say DOIT FAGGOT
>get all the fags off 4chin and on to /pnd/
WE scattered free thinkers could do it, but as for me I'll need a new IP and device.
Fedcoat jannies inflitrated and took down our revolution thread after all.
And I'm banned until next month on this IP
So it will have to be a tactical maneuver..
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bb0ea7 No.20686
>>20685
Nice puppers. Iz u teh doge?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
86a3af No.20687
>>20676
yep. when q+ has your stocking on his mantle you're kind of a big deal
B stands for big deal
and poetry he's got plenty
the modern warrior poet
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
87d312 No.20688
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
87d312 No.20689
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
51ad22 No.20690
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1f146e No.20691
>>20690
Still need to get more anons.
The lost ones.
M8GA.
So many have gone to so many different platforms. discord, matrix, signal, endchan, 4chin, 8chan.moe, kiwifarms, 420chan, plebbit, dread, twitter(X) etc.
I
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4a7257 No.20692
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
000000 No.20693
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
51ad22 No.20694
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
000000 No.20695
>>20694
Hes been on the run since i tracked him to Minnesota. Last i knew he ran to cali… Im hearing he may be in michigan now. Michaela was working with the feds and feeding me bad info and prolly reporting us to the feds as well… It amazes me how many pedovores we catch on the daily while the feds pretend to find people. It took days to track all jan 6ers with ip, and pings. Why cant they find a larping pedo??? They all in it together. Tore handled them all well considering she is married to a creep pedo also. Oh the webs we can weave. 🐉
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a2fa84 No.20696
>>20694
He won’t get far. Shouldn’t be hard to spot
Skeletor!
https://www.fox9.com/news/mn-fugitive-wanted-for-child-sexual-abuse-charges
>>20695
Tore shared him like 394 times.
TICK TOCK
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a2fa84 No.20697
>>20044
Tyg
Recap @ 400
E the friend on the run from the law
punisher and dove have quit posting on x
B team four year deltas in play
Flynn cross country paytriot grift.
DJT on trial.
As the world turns.
Kek
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a11731 No.20698
>>20695
>>20697
HW is angry.
JW lurking on pnd being LZ X-ray.
Clapping at someone who changed their story "Metaphorically Speaking"
Yeah… Beachhead is established.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
8ef8c2 No.20699
>>20688
dubs it is then
long live sgt b!
the poet
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
000000 No.20700
>>20696
Like i have said before, when the fat lady sings. We WIN. 💋 💅 🔥 Kek
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f3c77c No.20701
>>20700
Eyes are going on Humpty Dumpty now. Ty. God Speed 👻 🫡👊
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bb0ea7 No.20702
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bb0ea7 No.20703
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f3c77c No.20704
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a11731 No.20705
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4a7257 No.20706
twatter is so fucking gay I regret even making an account
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
000000 No.20707
>>20706
I dont even post anymore. Twitter is for the birds. Elon and his wef can all eat some 👻🥒
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a2fa84 No.20708
>>20707
Like clockwork. The dominoes begin to fall
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
000000 No.20709
>>20708
Watch who passes the buck now. There is more to come. We had to shack the small fruit from the tree so the only ones left stand out. Its gonna get much much more deeper. Buckle up 🔥
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a11731 No.20710
>>20709
I seek enlightenment. Listen and learn I will.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4a7257 No.20711
>>20707
>larping as some kind of enlightened name faggot on a dead board in the deepest bowels of Qtard country
>thinks that Elon Musk is alive and well acting out of his own volition
This is easily the most entertaining thread on the internet.
Great posts everyone.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
000000 No.20712
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a8108c No.20713
>>20711
>>20712
Who ordered the Alberta chili ?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4a7257 No.20714
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
c12a6d No.20715
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
000000 No.20716
>>20715
Black pill down! Black pill down!!! Kek
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
000000 No.20717
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4a7257 No.20718
>>20715
I was born in the larp, molded by it…
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a11731 No.20719
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
51ad22 No.20720
Today in History:
B team makes its move
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
8694fc No.20721
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
000000 No.20722
Has anyone asked J Sullivan why he promoted and supported a pedo??
Time to dig in 👻
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
51ad22 No.20723
>>20722
Some accts are bringing that up.
Many difficult conversations ahead.
Godspeed 👻
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
0fcbe6 No.20724
VV RADIO
FLIGHT PATTERN CONFIRMED
1pm eastern
Thank you for flying!
Godspeed 07
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
0fcbe6 No.20725
Steeple is lit
For 26
A 1
B 2
C. 3
4. D
E. 5
6. f
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
000000 No.20726
>>20725
Hmm, i think i got an idea with what you put down. O-9 A-F hex conversion 🤔
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
fd2e04 No.20728
>>20696
E Will Help You was a pedo the whole time?
not framed by the agencies?
weren't those rosenstein stories his?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
fd2e04 No.20729
>>20728
>>20728
>rosenstein stories
in the lin wood affidavits
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a2fa84 No.20730
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a2fa84 No.20731
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
0fcbe6 No.20732
>>20730
Amazing how such a large account would make such a claim with no sauce.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
0e3af4 No.20733
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4a7257 No.20734
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bb0ea7 No.20735
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
0fcbe6 No.20736
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a11731 No.20737
>>20730
Spot lights matter.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
0fcbe6 No.20738
>>20737
It’s funny how much disdain accounts like his show. So quick to objectively dismiss.
Wrong move fatso.
The pawn and the king go back in the same box when the game ends
Www.B.sof.cloud
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
51ad22 No.20739
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
877ce7 No.20740
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
000000 No.20741
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
114a60 No.20742
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2fe6b1 No.20743
>>20742
▶ B !!qMFQqVT8Uw 05/02/20 (Sat) 01:13:24 edb5a1 (14) No.50
"Knowing what you want and setting goals to achieve it, WINNING.
Wishing for things, but taking no action, LOSING."
~ Catherine Pulsifer
There are certain basic qualities and characteristics you've got to have. Number one: you've got to have a will to win.
~ Bob Richards
"VERITAS", "VERBUM VINCET", "Support By Truth", "_"
~ US ARMY PSYOP 2, 4, 7, 8
"Words hold power over men, Power even the sword would fear"
~Sgt B
https://youtu.be/0JvM8ppeNGA?si=oxz5I7-rauNGRlSu
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e31c2a No.20744
The head of RAND lives with the head of NASA Administration…. enjoy the dig anons
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e31c2a No.20745
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e31c2a No.20746
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ab5306 No.20747
>>20661
>>20672
>>20671
Hiiiii
I know that picture. This is nostalgic yet confusing.
Sooo how do I know you?
Collect a lot of hot wheels?
HANDBANANA??
Vera or Roxy?
Someone else?
^_^
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ab5306 No.20748
>>20661
>>20672
>>20671
Do you miss me?
have we met f2f?
^_^
>>20685
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
14137a No.20749
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ab5306 No.20750
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ab5306 No.20751
Knock knock, anyone home?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ab5306 No.20752
Meow
Listen to Habstrakt - The One (Asdek Remix) by Asdek on #SoundCloud
https://on.soundcloud.com/XXJL1
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
000000 No.20753
Jack be nibble, Jack be FAST, Jack choked on my 🕯️ stick
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
cf3552 No.20754
>>20753
hi 0000000
Que *blow torch*
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
000000 No.20755
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ab5306 No.20756
>>20755
i remember why i said fuck it to this place now.
no body appreciated me or what i was trying to do.
just because im not the "other" Qs
swear to god i wanna shut this whole thing down for good when im done.
whats worse i dont see much of a reason to assist when the "anons" want fairy tails and ghosts instead of the real thing.
so much for bringing my frogs along,
i wonder if we can do away with the anonymity?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1113e5 No.20757
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1113e5 No.20758
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1113e5 No.20759
>>20756
Foh Quantum faggot
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2a2ef5 No.20760
>>20045
at least some of you know its me.
and yeah i know who you are too ghosty.
tell v and the rest i said hi.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
877ce7 No.20761
>>20760
Ok man!
Glad to have you back
Got any thoughts on the next bread?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
16115f No.20762
>>20756
“Your” frogs?
We are all truth seekers here.
We deal in various methods on all platforms. If you want to dance.
Start the music
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ab5306 No.20763
the fuck kinda request is that M?
wanna listen to megalodon?
and yes,
my frogs.
wwg1wga.
you (frogs/frens)
are coming with us
you should just come over and talk to me f2f instead.
f2f is the only way im gonna know for sure.
confusing isnt it?
https://beatexs.com/n70uxhypq80x
https://beatexs.com/x5g328dubuke
https://beatexs.com/r60qy3okwhgt
like that?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ab5306 No.20764
>>20762
refer to post>>20763
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ab5306 No.20765
>>20761
yeah.
what happened in the 🏝 tunnels?
what's being kept under the vatican?
i know what (E) is and means.
whats in the safe?
they're not gonna like this game
full armor of god fren
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2a2ef5 No.20768
Tora3 embed. Click thumbnail to play. Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
40d5e6 No.20769
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2a2ef5 No.20770
>>20769
789
funny jokes. 915
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
40d5e6 No.20771
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2a2ef5 No.20772
>>20771
really?
is my day your day?
or is your day my day?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2a2ef5 No.20773
>>20771
im at the same place ive always been.
stop by
show me its really you
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
40d5e6 No.20774
>>20773
No can do pall. This larp don’t hunt.
🃏
You just need to turn on the light bulb and look on the wall.
Voila
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
40d5e6 No.20775
>>20774
kizo vml hillw ldg hsgzk verU
vvbbbbZ
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ab5306 No.20776
>>20045
How you like the races yesterday?
Q+ confirmation yesterday?
Didn't I say I left because no one appreciated me?
How long ago do you think I meant?
Dude I started Qresearch when it was just a board to post weird and spooky occult things. Now here we are.
5:5?
Now we're talking.
Q
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
67ce1d No.20778
>>20776
Yes. I enjoyed the races.
Which horse (s) did I bet on and win?
Funny you would call yourself Q.
Isn’t that a psyop?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
67ce1d No.20779
>>20776
Sauce the Q+ confirmation
Help us SEE
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2fe6b1 No.20780
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2fe6b1 No.20781
>>20776
Where’s the trips ?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2fe6b1 No.20782
>>20521
The biggest communication problem is we do not listen to understand. We listen to reply.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
18087c No.20783
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
40d5e6 No.20784
>>20783
Hi. I’m a bag of cats.
Patch will confirm
07
https://t.me/watchingwaiting/20997
Almost to 21k posts on
Watching and Waiting
🥂
SHOW THE MALL
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
13226c No.20786
BO here.
Will be a bit slower to check in.
Having internet stuff going on.
Still here. Always watching and waiting.
Just a heads up for those who Need to Know.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
000000 No.20787
>>20786
Get some star link kek
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
cf3552 No.20788
>>20045
G'day Qfags & my fellow boardfags
To whomever it may cocern,
Coincidences making things toolbar surreal
Did 6ft of rope & wobbly stool fail?
Try a Remington retirement plan!
Q
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
cf3552 No.20789
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
114a60 No.20790
>>20788
I’ll give (You) a hint
>>99
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b47d6a No.20791
>>20786
>>>20786
>Been looking into it. I can get it but wondering if is can get something faster without concast/xfinity.
>As that is who we left.
>And Fuck Concast/xfaggoty.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ab5306 No.20792
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4a7257 No.20793
>>20786
Can you do the shiney
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
69f102 No.20794
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4a7257 No.20795
>>20794
Excellent, what should our band name be?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
40d5e6 No.20796
>>20795
The tomataley crew
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
343b0a No.20797
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ab5306 No.20799
>>20795
Not transvestite fistfight that's for sure.
How about KYS?
How about The Fates?
Psyops on SQUQS
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ab5306 No.20800
<<20795
9 foot thick sheet of glass
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e1b52f No.20801
>>20172
I am 94.47485 percent sure I am the illusive [C]
… … … … … .
I need your help to understand what is needed from me.
I’m jumping around these boards on Q’s little scavenger hunt as always.
Leaving little notes everywhere.
Is this enough?
I do not feel I need to make my identity known.
I do however feel I need to contribute little crumbs that will connect BIG dots for you all.
I love God and trust him above all.
I hope this is the spark to enliven you all again
Make sure everything you do with Q is done with love and respect for the will of God.
Pray before you go about digging around.
The tides are changing my friends.
God bless you all
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e1b52f No.20802
>>20756
Drumroll please……….
“Q” is……..
Q Source
Q Documents
Q. + Mark = Matthew
Q. + Mark = Luke
Apparently ya’ll have never heard of the Holy Ghost and it shows.
[C] (filled with Q)
Get it?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2fe6b1 No.20803
>>20802
We SEE ALL.
We HEAR ALL.
Wizards & [WAR]locks.
BDTComplete 5/4/2020 UPDATED Visual Edits
Confirmations
Maria B. Drop was unscheduled.
Q drops timings (We stated when Q would post)
Q Next Drop timings (And Qs following posts, Then Echoed our message… ..)
Q drop Army Song
Q's message told over many drops. more than 10x+
Iterates our message over and over. WW.
The message continued today 5/3… … ..
EM Discussion, EM twitter rampage.
Airwaves tweet Don
Army Tweet
Video tweet Don
… ..
💀P💀A💀I💀N💀<3💀I💀S💀<3💀C💀O💀M💀I💀N💀G💀
++Blunt and Direct Time++
LEARN DOUBLE MEANINGS
DOUBLE != 2
Know your Enemy.
Know your Frens.
Be well read, Knowledge is Power.
You need to help the [C] see, then [C] will be exposed, only with [C] can this happen.
[C] = Cattle, [sheep], Citizens
[C] = Corruption, Crooks, Criminals
[C] = Cooperation, Community, Collective
[C] = … … … … … .
Learn your Q[l]ues
Clues : Direct or Covert messages for Anons to dig on
Clues : Riddles… … … .. "Future Proves Past" "Do you believe in coincidences?" Movies, etc.
Ques : comms for Operatives (Frens)
Ques : comms for Counter-Operatives (Enemies)
Ques : A signal, A hint, A light (Above & Beyond, AI Manhattan Project) (Code Names, Brackets, (periods), … … ..) (When Q asks you to think) etc.
Ques : Staging or setting up OP
Q : Questions
(Qou) : messages for You to do
Learn Double Meanings
[Symbolism will be their downfall.]
Remember Patches.
Remember Symbolism.
Remember Words.
Remember Right, Write, Rite.
Remember Game Theory.
Remember the GAME. (It is not a game.)
These lead to Light.
It's always been out in the open.
You just have to LOOK. Then see.
You MUST stay TOGETHER. Dig together, Meme together, Pray together
TOGETHER YOU ARE STRONG.
Symbolism = END.
FAKE NEWS ONLY DIVIDES.
DIVIDED YOU ARE WEAK.
TOGETHER YOU ARE STRONG.
FACT NEWS WILL UNITE.
FICTION IS A TOOL OF (((THEM))). FACTS MATTER.
TOGETHER YOU ARE STRONG.
Now is the time to Write, Right Now.
The silent war is ending (period)
You need no Rite to Write what is Right.
#1 protects your write. Right?
Write Now. Right Now?
5:5
(You/)r voices must be heard
You must sing as the mockingbird did, you must stop the birds waves.
Waves have a big influence, strong and unified.
Waves can be caught. Can You?
Waves can be changed. Can You?
Narratives will always exist. Will Yours?
Whose will shine?
Darkness requires lies, lies and more lies.
Truth only needs a single light.
A single light will light the darkest of rooms.
Each candle looses nothing when lighting another.
For each Candle lighted the darkness fades.
SCUM will rise to the top.
DIRT will fall to the bottom.
Dirt is easier to clean than Scum.
If you chop the legs off a table the whole table will fall.
United We Stand, Patriot.
Together We Win.
WWG1WGA!!!
Unity is Key.
WE are Key.
Maps are Key.
[C] is Key.
Waves are Key.
(You) are Key.
Memes are Key.
Truth is Key.
What is a door that has no key?
The key that opens all doors.
The 'Start'.
What is the Keystone. Re_read carefully. Like a Novel.
You have the Script.
You have the Screenplay.
You have the Playbook.
You know the Actors.
You know the Set.
You know the Score.
You have the Answers.
Let them know. Write Now.
START Producing.
Right Now!
All you need is your Audience.
We have it all.
You have all you need to START.
You are missing the connections.
Continue to build the MAP.
MAP provides the KEY.
KEY spreads the TRUTH.
TRUTH shines LIGHT.
LIGHT saves HUMANITY.
Future proves past.
Trust the plan.
The time has come.
The storm is now.
(You) are the storm.
You will know you are done when you see:
Look to Twitter:
Exactly this: "My fellow Americans, the Storm is upon us……."
God bless.
Stay TOGETHER.
Be STRONG.
Get ORGANIZED.
Be HEARD.
FIGHT the censorship.
You, the PEOPLE, have ALL the POWER.
You simply forgot how to PLAY.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d680e6 No.20804
>>20803
>confirmations
who is EM?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
675a67 No.20805
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
beb6c5 No.20806
>>20804
In that context EM is Elon Musk.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
beb6c5 No.20807
>>20805
Just digging deep my man.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2fe6b1 No.20808
>>20805
Digging deeply. Waiting and watching
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2fe6b1 No.20809
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2fe6b1 No.20810
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2eee52 No.20811
Who are the Laughing Men?
What do they do?
What is 'Stand Alone Complex'?
How do you create change?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d69d7a No.20812
>>20811
recommended reading for anyone who has not read or participated on the original abcu board https://8kun.top/abcu/catalog.html
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
000000 No.20813
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2eee52 No.20814
What battles are you fighting?
How will you win?
What does winning look like?
Why words over action?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
877ce7 No.20815
>>20814
Less than 6 again.
Make it count this time
SHOW THEM ALL
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4a7257 No.20816
>>20814
>Why words over action?
Words lead to action
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.